View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1565_low_27 (Length: 239)

Name: NF1565_low_27
Description: NF1565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF1565_low_27
[»] chr6 (1 HSPs)
chr6 (1-223)||(31742488-31742710)
[»] chr3 (4 HSPs)
chr3 (1-223)||(5165007-5165228)
chr3 (1-223)||(3804726-3804931)
chr3 (1-136)||(8435120-8435255)
chr3 (187-223)||(27149782-27149818)

Alignment Details
Target: chr6 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr6

Target: chr6; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 31742488 - 31742710
1 agagaatgaccggatgtttaaacttcatttctactctattcaaaatttgaaatttcaaaagtttatttgctcaaaattttggtgggaattttatgnnnnn 100  Q
    |||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||| ||         
31742488 agagaatgactggatggttaaacttcatttctactctattcaaaatttgaaatttcaaaagtttatttgctcaaaattttggtcgaaattttttggaaaa 31742587  T
101 nngtggtgggagtttgcctacttttttcaatttgaaatccaaataagttgtgagaatatcaatagccacattaaaccagaataaaaccgatgtattcttg 200  Q
      |||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||| |||||||||||||||||||||    
31742588 aagtggtgggagtttgcctacttttttcaatttgaaatccaaatgagctgtgagaatatcaatagccacattaaaccataataaaaccgatgtattcttg 31742687  T
201 tgaagagggagaggcgtgtttgt 223  Q
31742688 tgaagagggagaggcgtgtttgt 31742710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 166; Significance: 6e-89; HSPs: 4)
Name: chr3

Target: chr3; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 5165007 - 5165228
1 agagaatgaccggatgtttaaacttcatttctactctattcaaaatttgaaatttcaaaagtttatttgctcaaaattttggtgggaattttatgnnnnn 100  Q
    |||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||         
5165007 agagaatgacgggatgtttaaacttcatttctactctatttaaaatttgaaatttcaaaagtttatttgctcaaaattttggtgggaattttctggaaaa 5165106  T
101 nngtggtgggagtttgcctacttttttcaatttgaaatccaaataagttgtgagaatatcaatagccacattaaaccagaataaaaccgatgtattcttg 200  Q
      |||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||| ||||||||||||    
5165107 aagtggtgggagtttgcctacttttttcaatttgaaatccaaatgagctgtgagaatatcaatagccacattaaaccagaataaaactgatgtattcttg 5165206  T
201 tgaagagggagaggcgtgtttgt 223  Q
    |||||| ||||||| ||||||||    
5165207 tgaaga-ggagaggtgtgtttgt 5165228  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 3804931 - 3804726
1 agagaatgaccggatgtttaaacttcatttctactctattcaaaatttgaaatttcaaaagtttatttgctcaaaattttggtgggaattttatgnnnnn 100  Q
    ||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||         
3804931 agagaatgactagatgtttaaacttcatttctactctattcaaaatttgaaatttcaaaagtttatttgctcaaaattttggtgggaattttctggaaaa 3804832  T
101 nngtggtgggagtttgcctacttttttcaatttgaaatccaaataagttgtgagaatatcaatagccacattaaaccagaataaaaccgatgtattcttg 200  Q
      |||||||||||||||||||||||||||||||||||||||||       |||||||||||||||||||          ||||||||| |||||||||||    
3804831 aagtggtgggagtttgcctacttttttcaatttgaaatccaaa-------tgagaatatcaatagccac----------aataaaacctatgtattcttg 3804749  T
201 tgaagagggagaggcgtgtttgt 223  Q
    ||||||||||||| |||||||||    
3804748 tgaagagggagagacgtgtttgt 3804726  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 1 - 136
Target Start/End: Original strand, 8435120 - 8435255
1 agagaatgaccggatgtttaaacttcatttctactctattcaaaatttgaaatttcaaaagtttatttgctcaaaattttggtgggaattttatgnnnnn 100  Q
    |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||         
8435120 agagaatgactggatgtttaaacttcatttctactctattcaaaatttgaaatttcaaaaatttatttgctcaaaattttggtgggaattttatgaaaaa 8435219  T
101 nngtggtgggagtttgcctacttttttcaatttgaa 136  Q
8435220 aagtggtgggagtttgcctacttttttcaatttgaa 8435255  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 187 - 223
Target Start/End: Original strand, 27149782 - 27149818
187 ccgatgtattcttgtgaagagggagaggcgtgtttgt 223  Q
27149782 ccgatgtattcttgtgaagagggagaggcgtgtttgt 27149818  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 149624 times since January 2019
Visitors: 1517