View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1565_low_3 (Length: 471)

Name: NF1565_low_3
Description: NF1565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF1565_low_3
[»] chr4 (2 HSPs)
chr4 (10-454)||(53581252-53581696)
chr4 (60-199)||(53568003-53568142)

Alignment Details
Target: chr4 (Bit Score: 405; Significance: 0; HSPs: 2)
Name: chr4

Target: chr4; HSP #1
Raw Score: 405; E-Value: 0
Query Start/End: Original strand, 10 - 454
Target Start/End: Original strand, 53581252 - 53581696
10 acatcatcatgctttatgttaggaagaaactcatcatagtcatttgatccagaaaataaagcagcattttttctgcttgtgcacaagaatgaaaatgtaa 109  Q
    ||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||    
53581252 acatcataatgctttatgttaggaagaaactcatcatagtcttttgatccagaaaataaagcggcatttgttctgcttgtgcacaagaatgaaaatgtaa 53581351  T
110 ctttatgagcatctacagcaatccttctagcaaggctaaggagtggacctgcatgtgttccaaatgggaatgccaaaatggccacatgtagtttttcaac 209  Q
    ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
53581352 ctttatgagcatctacagcaatccttctagcaaggttaaggagtggacctgcatgtgttccaaatgggaatgccaaaacggccacatgtagtttttcaac 53581451  T
210 attaactgattcacctttatctctagacatccagtttttcaaacgtgcaattgaaaacatgtataactaagatcaatctttgatgtttttgtggccaaca 309  Q
53581452 attaactgattcacctttatctctagacatccagtttttcaaacgtgcaattgaaaacatgtataactaagatcaatctttgatgtttttgtggccaaca 53581551  T
310 ctacttatttttgggtggtctttatatgttgcaagaaagaaacaaactagaagaaaagttacacatatgtggttgaaaaataatagtaacaaattattaa 409  Q
    || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||    
53581552 ctgcttatttttgggtggtctttatatgttgcaagaaagaaacaaactagaagaaaagttacacatatgtggttggaaaataatagtaacaaattataaa 53581651  T
410 tgttaatataaggaggtgcaatgagcgtgacggtagttaggtgtt 454  Q
    |||||||||||||||||||||||||||||| ||||||||||||||    
53581652 tgttaatataaggaggtgcaatgagcgtgatggtagttaggtgtt 53581696  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 60 - 199
Target Start/End: Original strand, 53568003 - 53568142
60 agaaaataaagcagcattttttctgcttgtgcacaagaatgaaaatgtaactttatgagcatctacagcaatccttctagcaaggctaaggagtggacct 159  Q
    ||||||||||| | ||||| || || ||||||| ||||||||||||||||||||| |||| |||  ||||||  || |  | ||||||||||||||| |     
53568003 agaaaataaagtatcatttgttgtggttgtgcagaagaatgaaaatgtaactttaggagcctctgtagcaatttttttcactaggctaaggagtggagca 53568102  T
160 gcatgtgttccaaatgggaatgccaaaatggccacatgta 199  Q
    |||||||| |||||||||||||||||||  ||||||||||    
53568103 gcatgtgtgccaaatgggaatgccaaaacagccacatgta 53568142  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 142056 times since January 2019
Visitors: 1479