View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1565_low_30 (Length: 227)

Name: NF1565_low_30
Description: NF1565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1565_low_30
NF1565_low_30
[»] chr5 (1 HSPs)
chr5 (1-213)||(10812561-10812776)


Alignment Details
Target: chr5 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 1 - 213
Target Start/End: Original strand, 10812561 - 10812776
Alignment:
1 atatagagggaaaggatctagagttgcactttcatattgatgtaaatttggaccgttggatcaagatcggataaatcatgatcata-ttttttgttttaa 99  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||    
10812561 atatagagggaaaggatctagagttgcactttcatattgatgtaaatttggacggttggatcaagatcggataaatcatgatcatatttttttgttttaa 10812660  T
100 atttatcttgcaaagtg-tgggaaatgtgaaattaagagaaaattttaggacaactcggagtatact-nnnnnnnngagaactcataaatttaatggagt 197  Q
    | ||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||         ||||||||| ||||||||||||||    
10812661 aattatcttgcaaagtgttgggaaatgtgaaattaagagaaaattttaggataactcggagtatactaaaaaaaaagagaactcacaaatttaatggagt 10812760  T
198 tcggccctcaatacct 213  Q
    ||||||||||||||||    
10812761 tcggccctcaatacct 10812776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 149637 times since January 2019
Visitors: 1517