View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1565_low_32 (Length: 207)

Name: NF1565_low_32
Description: NF1565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1565_low_32
NF1565_low_32
[»] chr7 (4 HSPs)
chr7 (18-185)||(22625676-22625843)
chr7 (18-185)||(22633327-22633494)
chr7 (89-163)||(23354866-23354940)
chr7 (86-171)||(23366321-23366406)


Alignment Details
Target: chr7 (Bit Score: 160; Significance: 2e-85; HSPs: 4)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 18 - 185
Target Start/End: Original strand, 22625676 - 22625843
Alignment:
18 aatattacgtttgtttataagttataacttctctcttcaatttttgatcgattataattactattttttataggtacttgatctgcttaagtgttctttg 117  Q
    |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
22625676 aatattgcgtttgtttataagttataacttctctcttcaatttttgatcgattataattactatttgttataggtacttgatctgcttaagtgttctttg 22625775  T
118 ctttccaagtcaactttgacagatttgttcctagagaagaaaccatcccttgagagatcaaggtttat 185  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
22625776 ctttccaagtcaactttgacagatttgttcctagagaagaaaccatcccttgagagatcaaggtttat 22625843  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 18 - 185
Target Start/End: Complemental strand, 22633494 - 22633327
Alignment:
18 aatattacgtttgtttataagttataacttctctcttcaatttttgatcgattataattactattttttataggtacttgatctgcttaagtgttctttg 117  Q
    |||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
22633494 aatattgcgtttgtttataagttataacttctctcttcaatttttgatcgattacaattactattttttataggtacttgatctgcttaagtgttctttg 22633395  T
118 ctttccaagtcaactttgacagatttgttcctagagaagaaaccatcccttgagagatcaaggtttat 185  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
22633394 ctttccaagtcaactttgacagatttgttcctagagaagaaaccatcccttgagagatcaaggtttat 22633327  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 89 - 163
Target Start/End: Complemental strand, 23354940 - 23354866
Alignment:
89 aggtacttgatctgcttaagtgttctttgctttccaagtcaactttgacagatttgttcctagagaagaaaccat 163  Q
    ||||||| |||||  | |||||| |||||||||||||||||||| |||||||||| || ||||| ||||||||||    
23354940 aggtactcgatcttttaaagtgtgctttgctttccaagtcaactctgacagatttctttctagaaaagaaaccat 23354866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 86 - 171
Target Start/End: Original strand, 23366321 - 23366406
Alignment:
86 tataggtacttgatctgcttaagtgttctttgctttccaagtcaactttgacagatttgttcctagagaagaaaccatcccttgag 171  Q
    |||||||||||||| || | || ||||||||| | || ||||| |||||||| ||||| ||  |||  ||||||||||||||||||    
23366321 tataggtacttgatttgttaaaatgttctttgttgtcgaagtctactttgaccgatttctttttaggaaagaaaccatcccttgag 23366406  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 142199 times since January 2019
Visitors: 1479