View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1565_low_33 (Length: 207)

Name: NF1565_low_33
Description: NF1565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1565_low_33
NF1565_low_33
[»] chr3 (3 HSPs)
chr3 (19-186)||(3959692-3959860)
chr3 (30-86)||(39181791-39181847)
chr3 (30-76)||(49876118-49876164)
[»] chr1 (1 HSPs)
chr1 (19-186)||(14000972-14001138)
[»] chr5 (1 HSPs)
chr5 (30-84)||(6637365-6637419)
[»] chr4 (1 HSPs)
chr4 (30-86)||(26015136-26015192)
[»] chr7 (1 HSPs)
chr7 (19-86)||(26982397-26982464)
[»] chr8 (1 HSPs)
chr8 (19-79)||(43065333-43065393)


Alignment Details
Target: chr3 (Bit Score: 133; Significance: 2e-69; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 133; E-Value: 2e-69
Query Start/End: Original strand, 19 - 186
Target Start/End: Complemental strand, 3959860 - 3959692
Alignment:
19 aaataacctattagaaacatttacaa-catttttcttcaacgaccacatcgataaatatttgaccttatgccagatcagctcgaaaaccactatttgatg 117  Q
    |||||||||| ||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||| |||  ||||||||||||||||    
3959860 aaataacctaatagaaacatttacaaacatttttcttcaaccaccacatcgataaatatttgaccttatgccagatcaactcagaaaccactatttgatg 3959761  T
118 catactcttatctcgtacgaattaaaacttcatcgcaattcttgggaaatagcaatatatgtattatta 186  Q
    |||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
3959760 catactcttatctcatacgaattaaaacttcatcgcaatttttgggaaatagcaatatatgtattatta 3959692  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 39181791 - 39181847
Alignment:
30 tagaaacatttacaacatttttcttcaacgaccacatcgataaatatttgaccttat 86  Q
    ||||||||||||||| |||||||||||   |||||||||||||||||||||||||||    
39181791 tagaaacatttacaatatttttcttcagtcaccacatcgataaatatttgaccttat 39181847  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 30 - 76
Target Start/End: Original strand, 49876118 - 49876164
Alignment:
30 tagaaacatttacaacatttttcttcaacgaccacatcgataaatat 76  Q
    |||||||| |||||||||||||||||||| ||| |||||||||||||    
49876118 tagaaacagttacaacatttttcttcaaccaccgcatcgataaatat 49876164  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 124; Significance: 6e-64; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 19 - 186
Target Start/End: Original strand, 14000972 - 14001138
Alignment:
19 aaataacctattagaaacatttacaacatttttcttcaacgaccacatcgataaatatttgaccttatgccagatcagctcgaaaaccactatttgatgc 118  Q
    |||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||| |||  ||||||||||||||| |    
14000972 aaataacctaatagaaacatttacaacatttttcttcaaccaccacatcgataaatatttgaccttatgccatatcaactcagaaaccactatttgat-c 14001070  T
119 atactcttatctcgtacgaattaaaacttcatcgcaattcttgggaaatagcaatatatgtattatta 186  Q
    ||||||||||||| ||||||||||||||||||||||||| ||||| ||||||||||||||||||||||    
14001071 atactcttatctcatacgaattaaaacttcatcgcaatttttggggaatagcaatatatgtattatta 14001138  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 30 - 84
Target Start/End: Original strand, 6637365 - 6637419
Alignment:
30 tagaaacatttacaacatttttcttcaacgaccacatcgataaatatttgacctt 84  Q
    |||||||||| |||||||||||||||| | |||||||||||||||||||||||||    
6637365 tagaaacattgacaacatttttcttcagccaccacatcgataaatatttgacctt 6637419  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 26015192 - 26015136
Alignment:
30 tagaaacatttacaacatttttcttcaacgaccacatcgataaatatttgaccttat 86  Q
    ||||||||||||| ||||||||||||||   || |||||||||||||||||||||||    
26015192 tagaaacatttacgacatttttcttcaatccccgcatcgataaatatttgaccttat 26015136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 19 - 86
Target Start/End: Complemental strand, 26982464 - 26982397
Alignment:
19 aaataacctattagaaacatttacaacatttttcttcaacgaccacatcgataaatatttgaccttat 86  Q
    |||||||| | |||||| |||||||| ||||||||||| | ||||||| |||||||| ||||||||||    
26982464 aaataacccaatagaaatatttacaatatttttcttcagctaccacattgataaatacttgaccttat 26982397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 79
Target Start/End: Complemental strand, 43065393 - 43065333
Alignment:
19 aaataacctattagaaacatttacaacatttttcttcaacgaccacatcgataaatatttg 79  Q
    ||||||| || |||||||||||||| |||||||||  | | ||||||||||||||||||||    
43065393 aaataacataatagaaacatttacatcatttttctatagccaccacatcgataaatatttg 43065333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 142076 times since January 2019
Visitors: 1479