View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1565_low_34 (Length: 204)

Name: NF1565_low_34
Description: NF1565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1565_low_34
NF1565_low_34
[»] chr5 (1 HSPs)
chr5 (1-199)||(9424266-9424464)


Alignment Details
Target: chr5 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 199
Target Start/End: Complemental strand, 9424464 - 9424266
Alignment:
1 agcttgagaggaaagtataatataaccataaggagattgggagataaatgaacttacaatatcaccattagaaattcctaagttgaccaaagcagaagca 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9424464 agcttgagaggaaagtataatataaccataaggagattgggagataaatgaacttacaatatcaccattagaaattcctaagttgaccaaagcagaagca 9424365  T
101 agcttgagacatctttcataggtttctctccaagaaaatctaacatgatcattgtagatgatggaaactttgtcaccatacacaggttctgctcgttca 199  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||   |||||||||||    
9424364 agcttgagacatctttcataggtttctctccaagaaaatctaacatgatcattgtagatgatggaaactttgtcaccatacacagtggctgctcgttca 9424266  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 149053 times since January 2019
Visitors: 1515