View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1565_low_35 (Length: 203)

Name: NF1565_low_35
Description: NF1565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1565_low_35
NF1565_low_35
[»] chr6 (1 HSPs)
chr6 (1-191)||(2341964-2342154)
[»] chr2 (1 HSPs)
chr2 (1-171)||(33203551-33203721)


Alignment Details
Target: chr6 (Bit Score: 183; Significance: 3e-99; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 183; E-Value: 3e-99
Query Start/End: Original strand, 1 - 191
Target Start/End: Original strand, 2341964 - 2342154
Alignment:
1 aaataaaaattgttaatagttactcgaattaagtaatattttgattaaactaaactatgtattaacatgagaggtggaatagaagcagaatgagagcatc 100  Q
    |||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2341964 aaataaaaattgataatagttactcgaattaagtaatgttttgattaaactaaactatgtattaacatgagaggtggaatagaagcagaatgagagcatc 2342063  T
101 ttcgacacaaactgcataatttttaatttcattgaagcaaatataatgattaaagacatatacttacatgagccaccatttttcacaggtt 191  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2342064 ttcgacacaaactgcataatttttaatttcattgaagcaaatataatgattaaagacatatacttacatgagccaccatttttcacaggtt 2342154  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 1 - 171
Target Start/End: Original strand, 33203551 - 33203721
Alignment:
1 aaataaaaattgttaatagttactcgaattaagtaatattttgattaaa-ctaaactatgtattaacatgagaggtggaatagaagcagaatgagagcat 99  Q
    |||||||||| | |||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||    
33203551 aaataaaaat-gataatagttactcgaattaagtaatgttttgattaaaactaaactatgtattaacatgagagatggaatagaagcagaatgagagcat 33203649  T
100 cttcgacacaaactgcataatttttaatttcattgaagcaaatataatgattaaagacatatacttacatga 171  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33203650 cttcgatacaaactgcataatttttaatttcattgaagcaaatataatgattaaagacatatacttacatga 33203721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 141832 times since January 2019
Visitors: 1478