View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1565_low_36 (Length: 203)

Name: NF1565_low_36
Description: NF1565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF1565_low_36
[»] chr3 (1 HSPs)
chr3 (22-189)||(4191748-4191915)

Alignment Details
Target: chr3 (Bit Score: 164; Significance: 7e-88; HSPs: 1)
Name: chr3

Target: chr3; HSP #1
Raw Score: 164; E-Value: 7e-88
Query Start/End: Original strand, 22 - 189
Target Start/End: Original strand, 4191748 - 4191915
22 acctaagcattcaactgagatctgattagtatgcggtcgaaattgcatgaagtcatgtagtcaaatgagatttgaccgtataattagtatcagacaatcc 121  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
4191748 acctaagcattcaactgagatctgattagtatgcggtcgaaattgcatgaagtcatgtagtcaaatgagatttgaccgtataattagtatcagacgatcc 4191847  T
122 aaattgaaaacaagttttttcttattatttaagctattagcgtaaatttatatatttcaatcttcatc 189  Q
4191848 aaattgaaaacaagttttttcttattatttaagctattagcgtaaatttatatatttcaatcttcatc 4191915  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 142486 times since January 2019
Visitors: 1480