View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1565_low_4 (Length: 450)

Name: NF1565_low_4
Description: NF1565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1565_low_4
NF1565_low_4
[»] chr4 (1 HSPs)
chr4 (6-433)||(56175547-56175975)
[»] chr2 (2 HSPs)
chr2 (58-212)||(9997654-9997809)
chr2 (319-425)||(9997463-9997569)


Alignment Details
Target: chr4 (Bit Score: 392; Significance: 0; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 392; E-Value: 0
Query Start/End: Original strand, 6 - 433
Target Start/End: Complemental strand, 56175975 - 56175547
Alignment:
6 agataatacttaagaaacatgtgccatttaaaacaaatatagtaattgaccgctttcaaaatcacataacttaataactgcacctgtaggggcatttttc 105  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
56175975 agataatacttaagaaacatgtgccatttaaaacaaatatagtaattgaccgctttcaaaatcacataacttaataactggacctgtaggggcatttttc 56175876  T
106 ttttcaaatgacaggtgaaatcgttgatgagaaactcttcaggcggaagtccaaagagtttttgaaaagctgaatttgtttgaggagatcgcaaattaat 205  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
56175875 ttttcaaatgacaggtgaaatcgttgatgagaaactcttcaggcggaagtccaaagagtttttgaaaagctgaatttgtttgaggagatcgcaaattaat 56175776  T
206 ctacaattttatacatggat-nnnnnnntccaaataaggtcataactcaataatacttaagtgcaacgctgcaaataaaaactaccaaacggttcggtaa 304  Q
    |||||||||| |||||||||        ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
56175775 ctacaattttgtacatggataaaaaaaatccaaataaggtcataactcaataatacttaagtgcaacgctgcaaataaaaactaccaaacggttcggtaa 56175676  T
305 catagatggatccgtaccttcttccccacttctttctccattttacttatgtagtgttttacaacattcccacctctagtgttgtccaagaaaactttca 404  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
56175675 catagatggatccgtaccttcttccccacttctttctccattttacttatgtagtgttttacaacattcccacctctagtgttgtccaagaaaactttca 56175576  T
405 agtgcaacttagattggcatgtcagagct 433  Q
    |||||||||||||||||||||||||||||    
56175575 agtgcaacttagattggcatgtcagagct 56175547  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 64; Significance: 8e-28; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 58 - 212
Target Start/End: Complemental strand, 9997809 - 9997654
Alignment:
58 ctttcaaaatcacataacttaataa-ctgcacctgtaggggcatttttcttttcaaatgacaggtgaaatcgttgatgagaaactcttcaggcggaagtc 156  Q
    ||||||| ||||||||||  ||||| |  |||||| |||||||||||||| ||||||||||||||||| || ||||||||||| || ||||| |||||      
9997809 ctttcaacatcacataacagaataaaccacacctgcaggggcatttttctcttcaaatgacaggtgaagtcattgatgagaaattcctcaggtggaagcg 9997710  T
157 caaagagtttttgaaaagctgaatttgtttgaggagatcgcaaattaatctacaat 212  Q
    |||||||||| || || |||||||| ||||||||||| |||| |||||||| ||||    
9997709 caaagagtttctggaatgctgaattagtttgaggagaccgcatattaatctgcaat 9997654  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 319 - 425
Target Start/End: Complemental strand, 9997569 - 9997463
Alignment:
319 taccttcttccccacttctttctccattttacttatgtagtgttttacaacattcccacctctagtgttgtccaagaaaactttcaagtgcaacttagat 418  Q
    |||||||||||| || ||||| ||||||||| |||  |||| |||| | || || ||||||||||| ||||||||||||| | | |||||||||||||||    
9997569 taccttcttcccaacctctttttccattttatttaaatagtcttttgctacgtttccacctctagtattgtccaagaaaattcttaagtgcaacttagat 9997470  T
419 tggcatg 425  Q
    |||||||    
9997469 tggcatg 9997463  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 142194 times since January 2019
Visitors: 1479