View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1565_low_5 (Length: 429)

Name: NF1565_low_5
Description: NF1565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1565_low_5
NF1565_low_5
[»] chr4 (2 HSPs)
chr4 (14-412)||(39115946-39116345)
chr4 (125-174)||(37033061-37033110)


Alignment Details
Target: chr4 (Bit Score: 376; Significance: 0; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 376; E-Value: 0
Query Start/End: Original strand, 14 - 412
Target Start/End: Complemental strand, 39116345 - 39115946
Alignment:
14 ttcttagacacaaacctttcttctttgacacaaacctatctgctatgtgcacttgcgtctggactgggtaaggttaagaacaaaaactcacaaagctttc 113  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39116345 ttcttagacacaaacctttcttctttgacacaaacctatctgctatgtgcacttgcgtctggactgggtaaggttaagaacaaaaactcacaaagctttc 39116246  T
114 tgctatatttttacatattttttctaataatattgtcttgatgttttgatgcagtcaaccatatgttcctcctcaagcaaaacaaatgttacttttgcca 213  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39116245 tgctatatttttacatattttttctaataatattgtcttgatgttttgatgcagtcaaccatatgttcctcctcaagcaaaacaaatgttacttttgcca 39116146  T
214 t-aggatctatctaatggttatcatatttgtgtgtctaagttcatgtgtttcttgtcgataaagtaatgaagtttaaaccataagcatttatggagtttg 312  Q
    | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39116145 taaggatctatctaatggttatcatatttgtgtgtctaagttcatgtgtttcttgtcgataaagtaatgaagtttaaaccataagcatttatggagtttg 39116046  T
313 gtatctgatgcatatacgtctttatgtttgaagtactcaagcttcataactacgtacctgatttcctttgtcgaccactcacagcacgttttagatgttc 412  Q
     ||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
39116045 atatctgatgcaaatacgtctttatgtttgaagtattcaagcttcataactacgtacctgatttcctttgtcgaccactcacaacacgttttagatgttc 39115946  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 125 - 174
Target Start/End: Complemental strand, 37033110 - 37033061
Alignment:
125 tacatattttttctaataatattgtcttgatgttttgatgcagtcaacca 174  Q
    ||||||||||||||||||| | |||||| |||||| |||||||| |||||    
37033110 tacatattttttctaataacactgtcttaatgtttggatgcagttaacca 37033061  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 142278 times since January 2019
Visitors: 1479