View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1565_low_6 (Length: 424)

Name: NF1565_low_6
Description: NF1565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF1565_low_6
[»] chr5 (1 HSPs)
chr5 (17-409)||(24400738-24401130)

Alignment Details
Target: chr5 (Bit Score: 335; Significance: 0; HSPs: 1)
Name: chr5

Target: chr5; HSP #1
Raw Score: 335; E-Value: 0
Query Start/End: Original strand, 17 - 409
Target Start/End: Original strand, 24400738 - 24401130
17 atgtttaacgtacatgttcttttccggtatgaatcataccacagatgacaaaacagcttgaatctgaatgaacacatgaa-cataaacctag-aactcaa 114  Q
    |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||| ||||||     
24400738 atgtttgacgtacatgttcttttccggtatgaatcataccacagatgacaaaacagcttgaatctgaatgaacacaggaaacataaacctaggaactca- 24400836  T
115 gtgtatttggaggagaggaaaggattgcagaaaaatgcaaatgagagagtatgtatatgtgtgtaccatcttgtgttactagcaattattatatatatat 214  Q
    ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||    
24400837 gtgtatttggaggagagaaaaggattgcagaaaaatgcaaatgagagagtatgtatatgtttgtaccgtcttgtgttactagcaattattatatatatat 24400936  T
215 tggtaagtgagtgttttgttgaaaaacaaaggaagggtagtgtgagtggttgttggttccttatggcatgtgtgtaaaataaacgtgatcaacaaccagc 314  Q
    ||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24400937 tggtaagtgagtgatttgttgaaaaacaaaggaagggtagtgtaagtggttgttggttccttatggcatgtgtgtaaaataaacgtgatcaacaaccagc 24401036  T
315 aactaagggcactttagcaaataagcataagttggtaaatatcctgataacaataaaaatgagtttgtttgtattctcagtctcaccggtctctg 409  Q
    |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
24401037 aactaagggcactttagcaaataagcataagttggtaaatat-ctgataacaataaaaatgagtttgtttgtattctcagtctcaccggtctctg 24401130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 142376 times since January 2019
Visitors: 1480