View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1565_low_7 (Length: 411)

Name: NF1565_low_7
Description: NF1565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1565_low_7
NF1565_low_7
[»] chr2 (1 HSPs)
chr2 (15-396)||(37715017-37715401)


Alignment Details
Target: chr2 (Bit Score: 313; Significance: 1e-176; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 313; E-Value: 1e-176
Query Start/End: Original strand, 15 - 396
Target Start/End: Complemental strand, 37715401 - 37715017
Alignment:
15 caaaggttgatttttaattagtcgtatct--agaaatttannnnnnnaattttctgttggaataaatgaagaaaaaagtcggacttttctttgaaaaa-a 111  Q
    |||||||||||||||||||||||||||||  |||||||||       ||||||||||||||||||||||||||||||||||||||||||||||||||| |    
37715401 caaaggttgatttttaattagtcgtatctctagaaatttatttttttaattttctgttggaataaatgaagaaaaaagtcggacttttctttgaaaaaga 37715302  T
112 ttgaattgaatgacttcagtaacaatcactactaaaaagtaaaaacagttgaaatattgacaaaaattagagacgaaaaatttaacattggttagtacat 211  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
37715301 ttgaattgaatgacttcagtaacaatcactactaaaaagtaaaaacagttgaaatatcgacaaaaattagagacgaaaaatttaacattggttagtacat 37715202  T
212 ttttcgtctctaatacttgccacataattagagatggatattgcattttttcatttctaaattttcatagcgatttaaactttttcaaattgtgatcaaa 311  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37715201 ttttcgtctctaatacttgccacataattagagatggatattgcattttttcatttctaaattttcatagcgatttaaactttttcaaattgtgatcaaa 37715102  T
312 tggtatatatatatgccctcttatatattttctgtatttcannnnnnnncttggacaggatcaaaacactatccaaagccattaa 396  Q
    |||||||||||||||||||||||||||||||||||||||||        ||||||||||||| ||||||||||||||||||||||    
37715101 tggtatatatatatgccctcttatatattttctgtatttcattttttttcttggacaggatccaaacactatccaaagccattaa 37715017  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 137462 times since January 2019
Visitors: 1448