View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1565_low_8 (Length: 389)

Name: NF1565_low_8
Description: NF1565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1565_low_8
NF1565_low_8
[»] chr7 (17 HSPs)
chr7 (19-372)||(8457086-8457441)
chr7 (23-368)||(18815299-18815646)
chr7 (19-370)||(27987471-27987821)
chr7 (168-323)||(24819811-24819966)
chr7 (57-312)||(5196636-5196891)
chr7 (174-301)||(40891739-40891866)
chr7 (150-323)||(12121682-12121855)
chr7 (174-298)||(586904-587028)
chr7 (141-226)||(20705542-20705627)
chr7 (141-226)||(20873586-20873671)
chr7 (177-241)||(22865783-22865847)
chr7 (177-241)||(47548969-47549033)
chr7 (177-241)||(47553412-47553476)
chr7 (173-230)||(27869019-27869076)
chr7 (168-319)||(34981961-34982112)
chr7 (168-264)||(36575394-36575490)
chr7 (168-301)||(37075565-37075698)
[»] chr1 (9 HSPs)
chr1 (19-370)||(26995929-26996281)
chr1 (23-370)||(24544962-24545310)
chr1 (19-231)||(40392670-40392882)
chr1 (54-304)||(28520809-28521059)
chr1 (168-323)||(10004045-10004200)
chr1 (168-323)||(27030066-27030221)
chr1 (174-301)||(41342783-41342910)
chr1 (177-231)||(37668976-37669030)
chr1 (174-301)||(49369887-49370014)
[»] scaffold0289 (1 HSPs)
scaffold0289 (19-370)||(11030-11382)
[»] chr4 (18 HSPs)
chr4 (19-333)||(24059608-24059924)
chr4 (200-370)||(25135450-25135622)
chr4 (150-304)||(23158122-23158276)
chr4 (150-304)||(36279175-36279329)
chr4 (150-323)||(51872781-51872954)
chr4 (174-247)||(8111038-8111111)
chr4 (174-319)||(17826738-17826883)
chr4 (168-319)||(15649024-15649175)
chr4 (174-301)||(18116357-18116484)
chr4 (174-304)||(29123410-29123541)
chr4 (174-247)||(4303231-4303304)
chr4 (176-248)||(12915913-12915985)
chr4 (177-241)||(36951324-36951388)
chr4 (177-241)||(50693789-50693853)
chr4 (174-229)||(3621622-3621677)
chr4 (174-304)||(22340699-22340829)
chr4 (53-182)||(25135278-25135407)
chr4 (177-241)||(17469159-17469223)
[»] chr6 (6 HSPs)
chr6 (174-316)||(17228056-17228198)
chr6 (168-323)||(2894351-2894506)
chr6 (173-265)||(7218361-7218453)
chr6 (150-304)||(18295368-18295522)
chr6 (174-319)||(667385-667530)
chr6 (174-229)||(28604934-28604989)
[»] chr2 (9 HSPs)
chr2 (19-158)||(20007463-20007602)
chr2 (150-304)||(30275985-30276139)
chr2 (154-316)||(1258561-1258723)
chr2 (168-304)||(23384957-23385093)
chr2 (173-304)||(32349993-32350124)
chr2 (168-304)||(21963522-21963658)
chr2 (168-304)||(21964707-21964843)
chr2 (174-247)||(38938592-38938665)
chr2 (168-223)||(27914654-27914709)
[»] chr3 (14 HSPs)
chr3 (150-322)||(3514780-3514952)
chr3 (174-322)||(48547674-48547822)
chr3 (168-316)||(9819174-9819322)
chr3 (174-304)||(23603382-23603512)
chr3 (174-301)||(23571596-23571723)
chr3 (174-304)||(42462840-42462970)
chr3 (174-247)||(8595377-8595450)
chr3 (177-241)||(16664099-16664163)
chr3 (177-241)||(39632867-39632931)
chr3 (153-241)||(10754162-10754250)
chr3 (177-241)||(52196409-52196473)
chr3 (168-247)||(17153836-17153915)
chr3 (174-301)||(42459278-42459405)
chr3 (168-229)||(53152132-53152193)
[»] chr8 (5 HSPs)
chr8 (174-322)||(26077680-26077828)
chr8 (153-241)||(10801715-10801803)
chr8 (184-322)||(31423195-31423333)
chr8 (178-229)||(26390289-26390340)
chr8 (174-229)||(29532477-29532532)
[»] scaffold0041 (1 HSPs)
scaffold0041 (174-301)||(74418-74545)
[»] scaffold0032 (1 HSPs)
scaffold0032 (174-304)||(58368-58498)
[»] scaffold0003 (1 HSPs)
scaffold0003 (174-265)||(224737-224828)
[»] chr5 (9 HSPs)
chr5 (174-247)||(11266145-11266218)
chr5 (174-247)||(27891818-27891891)
chr5 (177-241)||(29322916-29322980)
chr5 (174-231)||(29150424-29150481)
chr5 (168-304)||(5824941-5825077)
chr5 (173-316)||(31962632-31962775)
chr5 (177-226)||(8896369-8896418)
chr5 (177-226)||(38931892-38931941)
chr5 (168-220)||(6678632-6678684)


Alignment Details
Target: chr7 (Bit Score: 317; Significance: 1e-179; HSPs: 17)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 317; E-Value: 1e-179
Query Start/End: Original strand, 19 - 372
Target Start/End: Complemental strand, 8457441 - 8457086
Alignment:
19 gaactgtattgatatcaagtcaaagggatattagaagccacaaacgaccgtaatgatcacacttaaaaaacaaatggtttctatcctctacacccccaca 118  Q
    ||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||    
8457441 gaactgtattgatatcaagtcaatgggatatcagaagccacaaacgaccgtaatgatcacaattaaaaaacaaatggtttttatcctctacacccccaca 8457342  T
119 tgaagtcacacaagatatcagtgaaacatccagaacatttctcttccacagataatcctttgtatcaagtctattcagaaagagacgccagacaaaaata 218  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
8457341 tgaagtcacacaagatatcagtgaaacatccagaacatttctcttccgcagataatcctttgtatcaagtctattcagaaagagacgccagacaaaaata 8457242  T
219 ttaacctttaacgaaactgctttatgccacgaaaaatgatgaaaatcctcagtaatgttattgtcaaccgttgttaagtaagaatacgcagattgcactg 318  Q
    ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |    
8457241 ttaacctttaacgaaaccgctttatgccacgaaaaatgatgaaaatcctcagtaatgttattgtcaaccgttgttaagtaagaatacgcagattgcacgg 8457142  T
319 tgtatttgttggaagggtaaagttttcac--acacctatcagccatgtcaacctac 372  Q
    |||||||||||||||||||||||||||||  |||||||||||||||||||||||||    
8457141 tgtatttgttggaagggtaaagttttcacacacacctatcagccatgtcaacctac 8457086  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 23 - 368
Target Start/End: Complemental strand, 18815646 - 18815299
Alignment:
23 tgtattgatatcaagtcaaagggatattagaagccacaaacgaccgtaatgatcacacttaaaaaacaaatggtttctatcctctacacccccacatgaa 122  Q
    |||||||||| |||| ||| ||||||| ||||| || ||||||| ||| |||||||||||| |||||||||||| | | ||||||||| |||||||||||    
18815646 tgtattgataccaagccaatgggatatcagaagtcaaaaacgactgtagtgatcacacttacaaaacaaatggtctttgtcctctacagccccacatgaa 18815547  T
123 gtcacacaagatatcagtgaaacatccagaacatttctcttccacagataatcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaa 222  Q
      | ||||||||| ||| ||||||||||||||||| ||||||| ||||| |||||||||| ||||||||||||||||||||||| ||||||| |||||||    
18815546 accgcacaagataccagggaaacatccagaacattcctcttcctcagattatcctttgtagcaagtctattcagaaagagacgctagacaaatatattaa 18815447  T
223 cctttaacgaaactgctttatgccacgaaaaatgatgaaaatcctcagtaatgttattgtcaaccgttgttaagtaagaatacgcagattgcactgtgta 322  Q
    ||||||||| ||| |||||||||||| ||||||||||||||||||||||||| |||  |||||||| ||||||||||||||| ||||||||||| |||||    
18815446 cctttaacggaaccgctttatgccacaaaaaatgatgaaaatcctcagtaatattagggtcaaccgctgttaagtaagaataagcagattgcacggtgta 18815347  T
323 tttgttggaagggtaaagttttcacac--acctatcagccatgtcaac 368  Q
    |||||||||||| | |||||| |||||  |||||||||||||| ||||    
18815346 tttgttggaaggatgaagtttccacaccaacctatcagccatgccaac 18815299  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 19 - 370
Target Start/End: Complemental strand, 27987821 - 27987471
Alignment:
19 gaactgtattgatatcaagtcaaagggatattagaagccacaaacgaccgtaatgatcacacttaaaaaacaaatggtttctatcctctacacccccaca 118  Q
    ||||||||| ||||||||| ||| ||||||| ||||||||||||||||  || ||||||||||||||||||||||||| | | | ||||||| |||||||    
27987821 gaactgtatcgatatcaagccaatgggatatcagaagccacaaacgac--tagtgatcacacttaaaaaacaaatggtctttgttctctacagccccaca 27987724  T
119 tgaagtcacacaagatatcagtgaaacatccagaacatttctcttccacagataatcctttgtatcaagtctattcagaaagagacgccagacaaaaata 218  Q
    ||||| | ||||||||| ||||||||||||||||| |||| ||||||  |||| |||||||||| ||||||||||||||||||||||||| |||||||||    
27987723 tgaagccgcacaagataccagtgaaacatccagaatattt-tcttccgtagattatcctttgtagcaagtctattcagaaagagacgccatacaaaaata 27987625  T
219 ttaacctttaacgaaactgctttatgccacgaaaaatgatgaaaatcctcagtaatgttattgtcaaccgttgttaagtaagaatacgcagattgcactg 318  Q
    ||||||||||||| ||| |||||||||||| ||||||||||||||||||||||||| ||| | ||||||| ||||||||||||||||| ||||||||       
27987624 ttaacctttaacggaaccgctttatgccacaaaaaatgatgaaaatcctcagtaatattagtatcaaccgctgttaagtaagaatacgtagattgcaaga 27987525  T
319 tgtatttgttggaagggtaaagttttcaca--cacctatcagccatgtcaacct 370  Q
    |||||||||||||| ||| |||||| ||||  ||||||||||||||| ||||||    
27987524 tgtatttgttggaatggtgaagtttccacacccacctatcagccatgccaacct 27987471  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 168 - 323
Target Start/End: Original strand, 24819811 - 24819966
Alignment:
168 agataatcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgccacgaaaaatgatgaaaatcct 267  Q
    |||| |||||||||| |||||||||||||||| || ||||| ||||||||||| || ||||| | ||| |||||| ||||  |||| |||| ||||||      
24819811 agattatcctttgtagcaagtctattcagaaaaagccgccaaacaaaaatattgacttttaagggaaccgctttaagccataaaaattgatcaaaatctg 24819910  T
268 cagtaatgttattgtcaaccgttgttaagtaagaatacgcagattgcactgtgtat 323  Q
    |||| |||||| |||| || | ||||||||||||||| ||||| ||||| ||||||    
24819911 cagtgatgttagtgtccactgctgttaagtaagaataagcagaatgcaccgtgtat 24819966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 57 - 312
Target Start/End: Original strand, 5196636 - 5196891
Alignment:
57 cacaaacgaccgtaatgatcacacttaaaaaacaaatggtttctatcctctacacccccacatgaagtcacacaagatatcagtgaaacatccagaacat 156  Q
    |||||||||||||| || || ||||||||||| |||||||  || |||||||   | |||||| | | | ||||||| |   | |||||||| || ||||    
5196636 cacaaacgaccgtagtggtcgcacttaaaaaataaatggtccctgtcctctaactcaccacataaggccgcacaagacacatgggaaacatcaagcacat 5196735  T
157 ttctcttccacagataatcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgccacgaaaaatg 256  Q
     |||||| |||| || |||||||||| |||||||||| |||||||| || |||| ||| ||||| || ||||||||||  || ||| ||||| ||||||     
5196736 atctcttgcacaaattatcctttgtagcaagtctatttagaaagagtcgtcagataaagatattcacttttaacgaaatcgccttaagccac-aaaaatt 5196834  T
257 atgaaaatcctc-agtaatgttattgtcaaccgttgttaagtaagaatacgcagatt 312  Q
    || |||  || | |||||||||| |||||||||| || ||||||||||| |||||||    
5196835 atcaaaccccaccagtaatgttaatgtcaaccgtcgtgaagtaagaataagcagatt 5196891  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 174 - 301
Target Start/End: Complemental strand, 40891866 - 40891739
Alignment:
174 tcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgccacgaaaaatgatgaaaatcctcagtaa 273  Q
    ||||||||| ||||||||||||||||||||||||| |||||||| ||||| ||||| | ||| |||||| ||||  |||| |||| ||| ||  |||| |    
40891866 tcctttgtagcaagtctattcagaaagagacgccaaacaaaaatgttaacttttaagggaaccgctttaagccataaaaattgatcaaactctgcagtga 40891767  T
274 tgttattgtcaaccgttgttaagtaaga 301  Q
    ||||| |||| |||| ||||||||||||    
40891766 tgttagtgtccaccgctgttaagtaaga 40891739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 150 - 323
Target Start/End: Original strand, 12121682 - 12121855
Alignment:
150 agaacatttctcttccacagataatcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgccacg 249  Q
    |||||||| ||||| |  |||| |||||||||| ||||||||||||||||||| ||||| |||||||||||||| ||||| |  || |||||| ||||      
12121682 agaacattcctcttgcgaagattatcctttgtagcaagtctattcagaaagagccgccaaacaaaaatattaacttttaagggtaccgctttaagccata 12121781  T
250 aaaaatgatgaaaatcctcagtaatgttattgtcaaccgttgttaagtaagaatacgcagattgcactgtgtat 323  Q
    |||| |||| |||||   |||| |||||| | || |||| |||||| |||||||| || || ||||| ||||||    
12121782 aaaattgatcaaaatttgcagtgatgttagtctccaccgctgttaaataagaataagctgaatgcaccgtgtat 12121855  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 174 - 298
Target Start/End: Original strand, 586904 - 587028
Alignment:
174 tcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgccacgaaaaatgatgaaaatcctcagtaa 273  Q
    ||||||||| |||||||||||| |||||||||||| |||||||||||||||||||| | ||| |||||| ||||  ||||| ||| ||| ||  |||| |    
586904 tcctttgtagcaagtctattcaaaaagagacgccaaacaaaaatattaacctttaagggaaccgctttaagccataaaaaacgatcaaactctgcagtga 587003  T
274 tgttattgtcaaccgttgttaagta 298  Q
    |||||  ||| |||| |||||||||    
587004 tgttagagtcgaccgctgttaagta 587028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 141 - 226
Target Start/End: Complemental strand, 20705627 - 20705542
Alignment:
141 gaaacatccagaacatttctcttccacagataatcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctt 226  Q
    ||||| || ||||| |||||||| | ||||| |||||||||  |||||||||||||||| |||||||| |||||||||||||||||    
20705627 gaaacctcaagaacgtttctcttgcgcagattatcctttgttgcaagtctattcagaaaaagacgccatacaaaaatattaacctt 20705542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 141 - 226
Target Start/End: Complemental strand, 20873671 - 20873586
Alignment:
141 gaaacatccagaacatttctcttccacagataatcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctt 226  Q
    ||||| || ||||| |||||||| | ||||| |||||||||  |||||||||||||||| |||||||| |||||||||||||||||    
20873671 gaaacctcaagaacgtttctcttgcgcagattatcctttgttgcaagtctattcagaaaaagacgccatacaaaaatattaacctt 20873586  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 177 - 241
Target Start/End: Complemental strand, 22865847 - 22865783
Alignment:
177 tttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgcttt 241  Q
    |||||| ||||||||||||||||||||||||| |||||||| |||||||| |||| |||||||||    
22865847 tttgtagcaagtctattcagaaagagacgccaaacaaaaatgttaaccttcaacggaactgcttt 22865783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 177 - 241
Target Start/End: Original strand, 47548969 - 47549033
Alignment:
177 tttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgcttt 241  Q
    |||||| ||||||||||||||||||||||||| |||||||| |||||||| |||| |||||||||    
47548969 tttgtagcaagtctattcagaaagagacgccaaacaaaaatgttaaccttcaacggaactgcttt 47549033  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 177 - 241
Target Start/End: Original strand, 47553412 - 47553476
Alignment:
177 tttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgcttt 241  Q
    |||||| ||||||||||||||||||||||||| |||||||| |||||||| |||| |||||||||    
47553412 tttgtagcaagtctattcagaaagagacgccaaacaaaaatgttaaccttcaacggaactgcttt 47553476  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 173 - 230
Target Start/End: Original strand, 27869019 - 27869076
Alignment:
173 atcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaac 230  Q
    |||||||||| ||||||||||||||||||||||||| ||||| || ||||||||||||    
27869019 atcctttgtagcaagtctattcagaaagagacgccaaacaaatatgttaacctttaac 27869076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 168 - 319
Target Start/End: Original strand, 34981961 - 34982112
Alignment:
168 agataatcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgccacgaaaaatgatgaaaatcct 267  Q
    |||| |||||||||| |||| | |||||||||||| | ||| |||||||||||||||||||| |  || |||||| ||||  |||| |||| ||| ||      
34981961 agattatcctttgtagcaaggcgattcagaaagagcctccaaacaaaaatattaacctttaaagggaccgctttaagccataaaaactgatcaaactctg 34982060  T
268 cagtaatgttattgtcaaccgttgttaagtaagaatacgcagattgcactgt 319  Q
    || | || ||| | || |||||||||||||||||||| || || ||||||||    
34982061 cattgatattagtatccaccgttgttaagtaagaataagctgaatgcactgt 34982112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 168 - 264
Target Start/End: Complemental strand, 36575490 - 36575394
Alignment:
168 agataatcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgccacgaaaaatgatgaaaat 264  Q
    |||| |||||||||| |||||||||||||||| || ||||| ||||||||||| || ||||| | ||| |||||| ||||  |||| |||| |||||    
36575490 agattatcctttgtagcaagtctattcagaaaaagccgccaaacaaaaatattgacttttaagggaaccgctttaagccataaaaattgatcaaaat 36575394  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 168 - 301
Target Start/End: Complemental strand, 37075698 - 37075565
Alignment:
168 agataatcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgccacgaaaaatgatgaaaatcct 267  Q
    |||| |||||||||| |||||| |||| ||||||| | ||| |||||||||||||| ||||| | ||| |||||| ||||  |||| |||| ||| ||      
37075698 agattatcctttgtagcaagtcgattctgaaagagcctccaaacaaaaatattaacttttaaaggaaccgctttaagccataaaaattgatcaaactctg 37075599  T
268 cagtaatgttattgtcaaccgttgttaagtaaga 301  Q
    |||| || ||| | || |||||||||||| ||||    
37075598 cagtgatattagtatccaccgttgttaagaaaga 37075565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 179; Significance: 2e-96; HSPs: 9)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 179; E-Value: 2e-96
Query Start/End: Original strand, 19 - 370
Target Start/End: Original strand, 26995929 - 26996281
Alignment:
19 gaactgtattgatatcaagtcaaagggatattagaagccacaaacgaccgtaatgatcacacttaaaaaacaaatggtttctatcctctacacccccaca 118  Q
    ||||||||| |||| |||| ||| | ||||| ||||||||||||||||| || |||||||| || |||||||||| || ||||||||||| |  | ||||    
26995929 gaactgtatcgataccaagccaatgagatatcagaagccacaaacgaccatagtgatcaca-ttgaaaaacaaatagtctctatcctctatagtctcaca 26996027  T
119 tgaagtcacacaagatatcagtgaaacatccagaacatttctcttccacagataatcctttgtatcaagtctattcagaaagagacgccagacaaaaata 218  Q
    ||||| |||||||||||   |||| |||||||||||||||||||||  || || |||||||| | |||||||||||||||||||||||||||||||||||    
26996028 tgaagccacacaagatacttgtgagacatccagaacatttctcttctgcaaattatcctttgcaccaagtctattcagaaagagacgccagacaaaaata 26996127  T
219 ttaacctttaacgaaactgctttatgccacgaaaaatgatgaaaatcctcagtaatgttattgtcaaccgttgttaagtaagaatacgcagattgcactg 318  Q
    ||||||||||||| ||  ||||| | |||| ||||||||||||||||||||||||| ||||| ||||||||||||||||||||||| ||||||||||| |    
26996128 ttaacctttaacggaatcgctttcttccacaaaaaatgatgaaaatcctcagtaatattattatcaaccgttgttaagtaagaataagcagattgcacgg 26996227  T
319 tgtatttgttggaagggtaaagttttcaca--cacctatcagccatgtcaacct 370  Q
    ||||||||||||||||||  ||||| ||||  ||||||||||||||||||||||    
26996228 tgtatttgttggaagggtgtagtttccacacccacctatcagccatgtcaacct 26996281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 160; E-Value: 4e-85
Query Start/End: Original strand, 23 - 370
Target Start/End: Complemental strand, 24545310 - 24544962
Alignment:
23 tgtattgatatcaagtcaaagggatattagaagccacaaacgaccgtaatgatcacacttaaaaaa-caaatggtttctatcctctacacccccacatga 121  Q
    ||||| |||| |||| ||| ||||||| | ||| ||||||||| |||| ||||||||||||||||| |||||||| ||||||||||||| ||||| ||||    
24545310 tgtatcgataccaagccaatgggatatcataaggcacaaacgatcgtagtgatcacacttaaaaaaacaaatggtctctatcctctacagccccaaatga 24545211  T
122 agtcacacaagatatcagtgaaacatccagaacatttctcttccacagataatcctttgtatcaagtctattcagaaagagacgccagacaaaaatatta 221  Q
    || | ||||||||| |||||||||||| |||||||||||||| |  |||| |||||||||| ||||||| ||||||||||||||||||||||||||||||    
24545210 agccgcacaagataccagtgaaacatc-agaacatttctctttcgaagattatcctttgtagcaagtctgttcagaaagagacgccagacaaaaatatta 24545112  T
222 acctttaacgaaactgctttatgccacgaaaaatgatgaaaatcctcagtaatgttattgtcaaccgttgttaagtaagaatacgcagattgcactgtgt 321  Q
    || ||||||| |||  ||||||| ||| ||||||||||||| |||||||||| ||||| ||||| || | ||||||||||||||||||||| |||| |||    
24545111 acttttaacggaaccactttatgacac-aaaaatgatgaaattcctcagtaacgttatcgtcaatcgctattaagtaagaatacgcagattacactatgt 24545013  T
322 atttgttggaagggtaaagttttcaca--cacctatcagccatgtcaacct 370  Q
    ||||||||||||| | |||||| ||||  |||||||||||| || ||||||    
24545012 atttgttggaaggatgaagtttccacacccacctatcagccgtgccaacct 24544962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 19 - 231
Target Start/End: Original strand, 40392670 - 40392882
Alignment:
19 gaactgtattgatatcaagtcaaagggatattagaagccacaaacgaccgtaatgatcacacttaaaaaacaaatggtttctatcctctacacccccaca 118  Q
    ||||||||| |||| |||||||| | ||||| ||||||||||||| |||||| ||||||||||| ||||||||||||| ||||||||||||| |||||||    
40392670 gaactgtatcgataccaagtcaatgagatatcagaagccacaaacaaccgtagtgatcacacttgaaaaacaaatggtgtctatcctctacagccccaca 40392769  T
119 tgaagtcacacaagatatcagtgaaacatccagaacatttctcttccacagataatcctttgtatcaagtctattcagaaagagacgccagacaaaaata 218  Q
    ||||| | || ||||||   |||||||||||||||||| |||| ||| || ||  |||||| ||  ||||||||| | ||| || |||||||||||||||    
40392770 tgaagccgcataagatacttgtgaaacatccagaacatatctcgtccgcaaattgtcctttatagtaagtctatttaaaaaaagtcgccagacaaaaata 40392869  T
219 ttaacctttaacg 231  Q
    |||||||||||||    
40392870 ttaacctttaacg 40392882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 54 - 304
Target Start/End: Complemental strand, 28521059 - 28520809
Alignment:
54 agccacaaacgaccgtaatgatcacacttaaaaaacaaatggtttctatcctctacacccccacatgaagtcacacaagatatcagtgaaacatccagaa 153  Q
    |||||||| |||||||| || ||||||||||||||||||||||  || |||||||   | |||||| | ||| ||||||| |  || || ||||| ||||    
28521059 agccacaatcgaccgtagtggtcacacttaaaaaacaaatggtccctgtcctctaactcaccacataaggtcgcacaagacacaagggagacatcaagaa 28520960  T
154 catttctcttccacagataatcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgccacgaaaa 253  Q
    |||| ||| | |||| || ||||| |||| ||||||||||||| ||||||||||| ||||| ||||| |||||||||||||| |||||| ||||| ||||    
28520959 cattcctcatacacaaattatcctctgtagcaagtctattcaggaagagacgccatacaaatatattcacctttaacgaaaccgctttaagccacaaaaa 28520860  T
254 atgatgaaaatcctcagtaatgttattgtcaaccgttgttaagtaagaata 304  Q
     |||||||| || ||| | |||||| |||||||| ||||||| ||||||||    
28520859 ttgatgaaactcttcaatgatgttaatgtcaaccattgttaaataagaata 28520809  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 168 - 323
Target Start/End: Original strand, 10004045 - 10004200
Alignment:
168 agataatcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgccacgaaaaatgatgaaaatcct 267  Q
    |||| |||||||||| ||||||||||||||||||| |||||  |||||||||| || ||||| | ||| |||||| ||||  |||| |||| ||||||      
10004045 agattatcctttgtagcaagtctattcagaaagagccgccaagcaaaaatattgacttttaaaggaaccgctttaagccataaaaattgatcaaaatctg 10004144  T
268 cagtaatgttattgtcaaccgttgttaagtaagaatacgcagattgcactgtgtat 323  Q
    |||| |||||| |||| |||| ||||||||||||||| ||||| ||||| ||||||    
10004145 cagtgatgttagtgtccaccgctgttaagtaagaataagcagaatgcaccgtgtat 10004200  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 168 - 323
Target Start/End: Original strand, 27030066 - 27030221
Alignment:
168 agataatcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgccacgaaaaatgatgaaaatcct 267  Q
    |||| ||||||| || |||||||||||| ||| || ||||| ||||||||||| || ||||| | ||| |||||| ||||  |||| |||| ||||||      
27030066 agattatcctttatagcaagtctattcaaaaaaagccgccaaacaaaaatattgacttttaagggaaccgctttaagccataaaaattgatcaaaatctg 27030165  T
268 cagtaatgttattgtcaaccgttgttaagtaagaatacgcagattgcactgtgtat 323  Q
    |||| |||||| |||| |||| ||||||||||||||| ||||| ||||| ||||||    
27030166 cagtgatgttagtgtccaccgctgttaagtaagaataagcagaatgcaccgtgtat 27030221  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 174 - 301
Target Start/End: Complemental strand, 41342910 - 41342783
Alignment:
174 tcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgccacgaaaaatgatgaaaatcctcagtaa 273  Q
    ||||||||| ||| ||||||||||||||||||||| |||||||| ||||| ||||| | ||| |||||| ||||  |||| |||| ||| ||  |||| |    
41342910 tcctttgtagcaaatctattcagaaagagacgccaaacaaaaatgttaacttttaaaggaaccgctttaagccataaaaattgatcaaactctgcagtga 41342811  T
274 tgttattgtcaaccgttgttaagtaaga 301  Q
    ||||| | || |||| ||||||||||||    
41342810 tgttagtatccaccgctgttaagtaaga 41342783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 177 - 231
Target Start/End: Original strand, 37668976 - 37669030
Alignment:
177 tttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacg 231  Q
    |||||||||||||||||||||||||||||||| |||||||| |||||||| ||||    
37668976 tttgtatcaagtctattcagaaagagacgccaaacaaaaatgttaaccttcaacg 37669030  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 174 - 301
Target Start/End: Original strand, 49369887 - 49370014
Alignment:
174 tcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgccacgaaaaatgatgaaaatcctcagtaa 273  Q
    ||||||||| ||||||||||||||||||||||||| | |||||| ||||| ||||| | ||| |||||| ||||  |||| |||| ||| ||  |||| |    
49369887 tcctttgtagcaagtctattcagaaagagacgccaaaaaaaaatgttaacttttaagggaaccgctttaagccataaaaattgatcaaactctgcagtga 49369986  T
274 tgttattgtcaaccgttgttaagtaaga 301  Q
    | ||  |||| ||||||||||| |||||    
49369987 tattggtgtccaccgttgttaaataaga 49370014  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0289 (Bit Score: 161; Significance: 9e-86; HSPs: 1)
Name: scaffold0289
Description:

Target: scaffold0289; HSP #1
Raw Score: 161; E-Value: 9e-86
Query Start/End: Original strand, 19 - 370
Target Start/End: Original strand, 11030 - 11382
Alignment:
19 gaactgtattgatatcaagtcaaagggatattagaagccacaaacgaccgtaatgatcacacttaaaaaacaaatggtttctatcctctacacccccaca 118  Q
    ||||||||| |||| |||| ||| |||| || | |||||||||||||||||||||||||||||||||||||||||||||| | ||||||| | || ||||    
11030 gaactgtatcgataccaagccaatgggagatcaaaagccacaaacgaccgtaatgatcacacttaaaaaacaaatggtttatgtcctctaaatccacaca 11129  T
119 tgaagtcacacaagatatcagtgaaacatccagaacatttctcttccacagataatcctttgtatcaagtctattcagaaagagacgccagacaaaaata 218  Q
    ||||| |||| |||||| ||| || ||||| |||||||||||||||| ||||| ||||||||||  |||||||||||| |||||||  || ||||| |||    
11130 tgaagccacataagataccagggagacatctagaacatttctcttccgcagattatcctttgtagaaagtctattcaggaagagacatcatacaaatata 11229  T
219 ttaacctttaacgaaactgctttatgccacgaaaaatgatgaaaatcctcagtaatgttattgtcaaccgttgttaagtaagaatacgcagattgcactg 318  Q
    ||||||||||||| |||  |||| |||||| ||||||||||||||||||||||||| ||| ||||||| | ||||||||||||||| ||||||||||| |    
11230 ttaacctttaacggaacctctttgtgccacaaaaaatgatgaaaatcctcagtaatattagtgtcaactgctgttaagtaagaataagcagattgcacag 11329  T
319 tgtatttgttggaagggtaaagttttcaca-cacctatcagccatgtcaacct 370  Q
    ||||||| || |||||||  ||||| |||| || | |||||||||| ||||||    
11330 tgtatttattcgaagggtggagtttccacaccatccatcagccatgccaacct 11382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 138; Significance: 5e-72; HSPs: 18)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 138; E-Value: 5e-72
Query Start/End: Original strand, 19 - 333
Target Start/End: Original strand, 24059608 - 24059924
Alignment:
19 gaactgtattgatatcaagtcaaagggatattagaagccacaaacgaccgtaatgatcacacttaaaaaacaaatggtttctatcctctacacccccaca 118  Q
    ||||||||| |||| |||| ||| ||||||| |||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||| |||||||    
24059608 gaactgtatcgataccaagccaatgggatatcagaagccacaaacgaccgtagtgatcacacttaaaaaacaaatggtctctatcctctacagccccaca 24059707  T
119 tgaagtcacacaagatatcagtgaaacatccagaacatttctcttccacagataatcctttgtatcaagtctattcagaaagagacgccagacaaaaata 218  Q
    ||||| |  |||||||| | |||||||||||||||| | |||| ||| || ||  ||||||||| |||||||| ||| ||||||||| || |||||||||    
24059708 tgaagccgtacaagatacctgtgaaacatccagaacctgtctcgtccgcaaattgtcctttgtagcaagtctactcataaagagacgtcaaacaaaaata 24059807  T
219 ttaacctttaacgaaactgctttatgccacgaaaaatgatgaaaatcctcagtaatgttattgtcaaccgttgttaagtaagaatacgcagattg--cac 316  Q
    ||||| ||||||||||| | ||||||  |   ||||||| ||||||||||| |||| ||||||||||   |||||||||||||||| ||| ||||  |||    
24059808 ttaacttttaacgaaaccgttttatgttatagaaaatgacgaaaatcctcactaatattattgtcaaatattgttaagtaagaataagcatattgtacac 24059907  T
317 tgtgtatttgttggaag 333  Q
     ||||||||||||||||    
24059908 ggtgtatttgttggaag 24059924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 200 - 370
Target Start/End: Original strand, 25135450 - 25135622
Alignment:
200 gagacgccagacaaaaatattaacctttaacgaaactgctttatgccacgaaaaatgatgaaaatcctca-gtaatgttattgtcaaccgttgttaagta 298  Q
    ||||||| ||||||| |||||||||||||| | ||| |||||| ||||  |||||| ||||||||| | | ||||| ||| ||||||||| |||||| ||    
25135450 gagacgctagacaaatatattaacctttaatggaaccgctttaagccaaaaaaaattatgaaaatcttaaagtaatattagtgtcaaccgctgttaaata 25135549  T
299 agaatacgcagattgcactgtgtatttgttggaagggtaaag-ttttcacacacctatcagccatgtcaacct 370  Q
    |||||| ||||||||||| |||||||||| |||||| | ||| ||  ||| ||||||||||||||| ||||||    
25135550 agaataagcagattgcacggtgtatttgtgggaaggatgaagcttcccacccacctatcagccatgccaacct 25135622  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 150 - 304
Target Start/End: Complemental strand, 23158276 - 23158122
Alignment:
150 agaacatttctcttccacagataatcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgccacg 249  Q
    |||||||| ||||| |  |||| |||||||||| ||||||||||||||||||| ||||| |||||||||||||| ||||| |  ||||||||| ||||      
23158276 agaacattcctcttgcgaagattatcctttgtagcaagtctattcagaaagagccgccaaacaaaaatattaacttttaaggggactgctttaagccata 23158177  T
250 aaaaatgatgaaaatcctcagtaatgttattgtcaaccgttgttaagtaagaata 304  Q
    |||| |||| |||||   |||| |||||| |||| |||| |||||||||||||||    
23158176 aaaattgatcaaaatatgcagtgatgttagtgtccaccgctgttaagtaagaata 23158122  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 150 - 304
Target Start/End: Complemental strand, 36279329 - 36279175
Alignment:
150 agaacatttctcttccacagataatcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgccacg 249  Q
    |||||||| ||||| |  |||| |||||||||| ||||||||||||||||||  ||||| |||||||||||||| ||||| | ||| |||||| ||||      
36279329 agaacattcctcttacgaagattatcctttgtagcaagtctattcagaaagaaccgccaaacaaaaatattaacttttaagggaaccgctttaagccata 36279230  T
250 aaaaatgatgaaaatcctcagtaatgttattgtcaaccgttgttaagtaagaata 304  Q
    |||| |||| ||||||  |||| |||||| |||| |||| |||||||||||||||    
36279229 aaaattgatcaaaatctgcagtgatgttagtgtccaccgctgttaagtaagaata 36279175  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 150 - 323
Target Start/End: Original strand, 51872781 - 51872954
Alignment:
150 agaacatttctcttccacagataatcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgccacg 249  Q
    |||||||| ||||| |  |||| |||||||||| ||||||||||||||||||| ||||| |||||||||||||| ||||| |  || |||||| ||||      
51872781 agaacattcctcttgcgaagattatcctttgtagcaagtctattcagaaagagccgccaaacaaaaatattaacttttaagggtaccgctttaagccata 51872880  T
250 aaaaatgatgaaaatcctcagtaatgttattgtcaaccgttgttaagtaagaatacgcagattgcactgtgtat 323  Q
    |||| |||  ||||||  |||| |||||| ||||  ||| |||||| |||||||| || || ||||| ||||||    
51872881 aaaattgaacaaaatctgcagtgatgttagtgtctgccgctgttaaataagaataagctgaatgcaccgtgtat 51872954  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 174 - 247
Target Start/End: Original strand, 8111038 - 8111111
Alignment:
174 tcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgcca 247  Q
    ||||||||  ||||||||||||||||||||||||| |||||||||||||||||||| | ||| |||||| ||||    
8111038 tcctttgttgcaagtctattcagaaagagacgccatacaaaaatattaacctttaatggaaccgctttaagcca 8111111  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 174 - 319
Target Start/End: Complemental strand, 17826883 - 17826738
Alignment:
174 tcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgccacgaaaaatgatgaaaatcctcagtaa 273  Q
    ||||||||| ||||||||||||||||||||||||| |||||||| ||||| ||||| |||||  ||||| ||||  |||| |||| ||| ||  |||| |    
17826883 tcctttgtagcaagtctattcagaaagagacgccaaacaaaaatgttaacttttaaggaaaccactttaagccataaaaattgatcaaactctacagtga 17826784  T
274 tgttattgtcaaccgttgttaagtaagaatacgcagattgcactgt 319  Q
    | ||  |||| ||||||||||| ||||| || || || ||||||||    
17826783 tattgatgtccaccgttgttaaataagagtaagctgaatgcactgt 17826738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 168 - 319
Target Start/End: Complemental strand, 15649175 - 15649024
Alignment:
168 agataatcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgccacgaaaaatgatgaaaatcct 267  Q
    |||| |||||||||| |||| | |||||||||||| | ||| |||||||||||||||||||| |  ||||||||| ||||  | ||||||| ||| ||      
15649175 agattatcctttgtagcaaggcgattcagaaagagcctccaaacaaaaatattaacctttaaagggactgctttaagccataataaatgatcaaactctg 15649076  T
268 cagtaatgttattgtcaaccgttgttaagtaagaatacgcagattgcactgt 319  Q
    || | || ||| | || |||||||||||||||||||| || || ||||||||    
15649075 cattgatattagtatccaccgttgttaagtaagaataagctgaatgcactgt 15649024  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 174 - 301
Target Start/End: Complemental strand, 18116484 - 18116357
Alignment:
174 tcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgccacgaaaaatgatgaaaatcctcagtaa 273  Q
    ||||||||| ||| ||||||||||||||||||||| |||||||| ||||| ||||| | ||| |||||| ||||  |||| |||| ||| ||  |||| |    
18116484 tcctttgtagcaaatctattcagaaagagacgccaaacaaaaatgttaacttttaaaggaaccgctttaagccataaaaattgatcaaactctgcagtga 18116385  T
274 tgttattgtcaaccgttgttaagtaaga 301  Q
    ||||| | || |||| ||||||||||||    
18116384 tgttagtatccaccgctgttaagtaaga 18116357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 174 - 304
Target Start/End: Complemental strand, 29123541 - 29123410
Alignment:
174 tcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaa-cgaaactgctttatgccacgaaaaatgatgaaaatcctcagta 272  Q
    ||||||||| ||||||||||||||||||||||||| |||||||| ||||| |||||  ||||| |||||| ||||  |||| |||| ||| ||  ||||     
29123541 tcctttgtagcaagtctattcagaaagagacgccaaacaaaaatgttaacttttaagggaaaccgctttaagccataaaaattgatcaaactctgcagtg 29123442  T
273 atgttattgtcaaccgttgttaagtaagaata 304  Q
    || ||  |||| ||||||||||| ||||||||    
29123441 atattgatgtccaccgttgttaaataagaata 29123410  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 174 - 247
Target Start/End: Complemental strand, 4303304 - 4303231
Alignment:
174 tcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgcca 247  Q
    ||||||||| |||||||||||||||| |||||||| |||||||||||||| ||||| | ||| |||||| ||||    
4303304 tcctttgtagcaagtctattcagaaaaagacgccaaacaaaaatattaacttttaagggaaccgctttaagcca 4303231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 176 - 248
Target Start/End: Original strand, 12915913 - 12915985
Alignment:
176 ctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgccac 248  Q
    ||||||| ||| ||||||||||||||||||||| |||||||| ||||||||||||| ||| || ||| |||||    
12915913 ctttgtagcaattctattcagaaagagacgccaaacaaaaatgttaacctttaacggaaccgccttaagccac 12915985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 177 - 241
Target Start/End: Original strand, 36951324 - 36951388
Alignment:
177 tttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgcttt 241  Q
    |||||| ||||||||||||||||||||||||| |||||||| |||||||| |||| ||| |||||    
36951324 tttgtagcaagtctattcagaaagagacgccatacaaaaatgttaaccttcaacggaaccgcttt 36951388  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 177 - 241
Target Start/End: Complemental strand, 50693853 - 50693789
Alignment:
177 tttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgcttt 241  Q
    |||||| ||||||||||||||||||||||||| |||||||| |||||||| |||| ||| |||||    
50693853 tttgtagcaagtctattcagaaagagacgccaaacaaaaatgttaaccttcaacggaaccgcttt 50693789  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 174 - 229
Target Start/End: Original strand, 3621622 - 3621677
Alignment:
174 tcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaa 229  Q
    ||||||||  |||||||||||||||| |||||||| ||||||||||||||||||||    
3621622 tcctttgttgcaagtctattcagaaaaagacgccatacaaaaatattaacctttaa 3621677  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 174 - 304
Target Start/End: Original strand, 22340699 - 22340829
Alignment:
174 tcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgccacgaaaaatgatgaaaatcctcagtaa 273  Q
    ||||||||| |||||||||| |||||||||||||| |||||||| ||||| ||||| | ||| |||||| ||||  |||| |||| |||  |  |||| |    
22340699 tcctttgtagcaagtctatttagaaagagacgccaaacaaaaatgttaacttttaagggaaccgctttaagccataaaaattgatcaaacactgcagtga 22340798  T
274 tgttattgtcaaccgttgttaagtaagaata 304  Q
    | ||  |||| ||||||||||| ||||||||    
22340799 tattgatgtccaccgttgttaaataagaata 22340829  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 53 - 182
Target Start/End: Original strand, 25135278 - 25135407
Alignment:
53 aagccacaaacgaccgtaatgatcacacttaaaaaacaaatggtttctatcctctacacccccacatgaagtcacacaagatatcagtgaaacatccaga 152  Q
    ||||||||| |||||  | ||||| ||||||||||||||||||| | | |||||||   ||||||| |||| | |||||||    || || |||||||||    
25135278 aagccacaatcgaccaaagtgatcgcacttaaaaaacaaatggtctttgtcctctaataccccacaagaagccgcacaagaagctagggagacatccaga 25135377  T
153 acatttctcttccacagataatcctttgta 182  Q
    ||||||||||||| || || ||||||||||    
25135378 acatttctcttccgcaaattatcctttgta 25135407  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 177 - 241
Target Start/End: Complemental strand, 17469223 - 17469159
Alignment:
177 tttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgcttt 241  Q
    |||||| |||||||||||||||||||| |||| |||||||| |||||||| |||| ||| |||||    
17469223 tttgtagcaagtctattcagaaagagatgccaaacaaaaatgttaaccttcaacggaaccgcttt 17469159  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 75; Significance: 2e-34; HSPs: 6)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 174 - 316
Target Start/End: Original strand, 17228056 - 17228198
Alignment:
174 tcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgccacgaaaaatgatgaaaatcctcagtaa 273  Q
    ||||||||| |||||||||| |||||||||||||||||||| || || || ||||||| |||||||||| ||||| ||||||||||||| || ||||| |    
17228056 tcctttgtagcaagtctatttagaaagagacgccagacaaatatgttcacatttaacggaactgctttaagccacaaaaaatgatgaaactcttcagtga 17228155  T
274 tgttattgtcaaccgttgttaagtaagaatacgcagattgcac 316  Q
    | ||| ||||||||| |||||| ||||||||||| ||||||||    
17228156 ttttagtgtcaaccgctgttaaataagaatacgccgattgcac 17228198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 168 - 323
Target Start/End: Original strand, 2894351 - 2894506
Alignment:
168 agataatcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgccacgaaaaatgatgaaaatcct 267  Q
    |||| |||||||||| |||||||||||||||| || ||||| |||||||||||||| ||||| | ||| |||||| ||||   ||| |||| ||||||      
2894351 agattatcctttgtagcaagtctattcagaaaaagccgccaaacaaaaatattaacttttaagggaaccgctttaagccatagaaattgatcaaaatctg 2894450  T
268 cagtaatgttattgtcaaccgttgttaagtaagaatacgcagattgcactgtgtat 323  Q
    |||| |||||| | || |||| ||||||||||||||| ||||| ||||| ||||||    
2894451 cagtgatgttagtatccaccgctgttaagtaagaataagcagaatgcaccgtgtat 2894506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 173 - 265
Target Start/End: Complemental strand, 7218453 - 7218361
Alignment:
173 atcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgccacgaaaaatgatgaaaatc 265  Q
    |||||||||| |||||||||||||||| |||||||| |||||||| ||||||||||||| ||| || ||| ||||  |||| |||||||||||    
7218453 atcctttgtagcaagtctattcagaaaaagacgccaaacaaaaatgttaacctttaacggaaccgccttaagccataaaaattgatgaaaatc 7218361  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 150 - 304
Target Start/End: Complemental strand, 18295522 - 18295368
Alignment:
150 agaacatttctcttccacagataatcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgccacg 249  Q
    |||||||| ||||| |  |||| |||||||||| ||||||||||||||||||| ||||| |||||||||||||| ||||| |  || |||||| ||||      
18295522 agaacattcctcttgcgaagattatcctttgtagcaagtctattcagaaagagccgccaaacaaaaatattaacttttaagggtaccgctttaagccata 18295423  T
250 aaaaatgatgaaaatcctcagtaatgttattgtcaaccgttgttaagtaagaata 304  Q
    |||| |||| |||||   |||| |||||| | || |||| |||||| ||||||||    
18295422 aaaattgatcaaaatatgcagtgatgttagtatccaccgctgttaaataagaata 18295368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 174 - 319
Target Start/End: Original strand, 667385 - 667530
Alignment:
174 tcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgccacgaaaaatgatgaaaatcctcagtaa 273  Q
    ||||||||| ||||||||||||||||||||||||| |||||||| ||||||||||| | |||  ||||| ||||  |||| |||| ||| ||  |||| |    
667385 tcctttgtagcaagtctattcagaaagagacgccaaacaaaaatgttaacctttaagggaaccactttaagccataaaaattgattaaactctgcagtga 667484  T
274 tgttattgtcaaccgttgttaagtaagaatacgcagattgcactgt 319  Q
    ||||  |||| |||| |||||| ||||| || || || ||||||||    
667485 tgttgatgtccaccgctgttaaataagagtaagctgaatgcactgt 667530  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 174 - 229
Target Start/End: Complemental strand, 28604989 - 28604934
Alignment:
174 tcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaa 229  Q
    ||||||||  |||||||||||||||| |||||||| ||||||||||||||||||||    
28604989 tcctttgttgcaagtctattcagaaaaagacgccatacaaaaatattaacctttaa 28604934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 61; Significance: 4e-26; HSPs: 9)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 19 - 158
Target Start/End: Original strand, 20007463 - 20007602
Alignment:
19 gaactgtattgatatcaagtcaaagggatattagaagccacaaacgaccgtaatgatcacacttaaaaaacaaatggtttctatcctctaca-cccccac 117  Q
    ||||| ||| |||| |||| ||| ||||||| ||||||||||||| |||||| ||||||||||| ||||||||||||| |||||||||||||   |||||    
20007463 gaactatatcgataccaagccaatgggatatcagaagccacaaacaaccgtagtgatcacactt-aaaaacaaatggtctctatcctctacagaacccac 20007561  T
118 atgaagtcacacaagatatcagtgaaacatccagaacattt 158  Q
    ||||||  |||||||||| | |||||||||| |||||||||    
20007562 atgaagctacacaagatacctgtgaaacatctagaacattt 20007602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 150 - 304
Target Start/End: Original strand, 30275985 - 30276139
Alignment:
150 agaacatttctcttccacagataatcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgccacg 249  Q
    |||||||| ||||| |  |||| |||||||||| | ||||||||||||||||| | ||| |||||||||||||| ||||| | ||| |||||| ||||      
30275985 agaacattcctcttgcgaagattatcctttgtagcgagtctattcagaaagagcctccaaacaaaaatattaacttttaagggaaccgctttaagccata 30276084  T
250 aaaaatgatgaaaatcctcagtaatgttattgtcaaccgttgttaagtaagaata 304  Q
    |||| |||| ||||||  |||| |||||| |||| |||| |||||||||||||||    
30276085 aaaattgatcaaaatctgcagtgatgttagtgtccaccgctgttaagtaagaata 30276139  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 154 - 316
Target Start/End: Original strand, 1258561 - 1258723
Alignment:
154 catttctcttccacagataatcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgccacgaaaa 253  Q
    ||||||| || |||| || ||| |||||| ||||||||||||||||||||||| | ||||| || |||||||| |||| ||| |||||   |||  ||||    
1258561 catttcttttacacaaattatcttttgtagcaagtctattcagaaagagacgcaaaacaaatatgttaaccttcaacggaaccgcttttaaccataaaaa 1258660  T
254 atgatgaaaatcctcagtaatgttattgtcaaccgttgttaagtaagaatacgcagattgcac 316  Q
     |||| |||||| |||| ||||||| |||| ||||  |||||||| ||||| || ||||||||    
1258661 ttgattaaaatcttcagaaatgttagtgtccaccgccgttaagtacgaataagccgattgcac 1258723  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 168 - 304
Target Start/End: Original strand, 23384957 - 23385093
Alignment:
168 agataatcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgccacgaaaaatgatgaaaatcct 267  Q
    |||| |||||||||| || |||||||||||||||| ||||| |||||||||||||| ||||| | ||| |||||| ||||  |||| |||| ||| ||      
23384957 agattatcctttgtagcatgtctattcagaaagagccgccaaacaaaaatattaacttttaaaggaaccgctttaagccataaaaattgatcaaactctg 23385056  T
268 cagtaatgttattgtcaaccgttgttaagtaagaata 304  Q
    |||| || ||| | || |||  |||||||||||||||    
23385057 cagtgatattagtatccaccactgttaagtaagaata 23385093  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 173 - 304
Target Start/End: Original strand, 32349993 - 32350124
Alignment:
173 atcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgccacgaaaaatgatgaaaatcctcagta 272  Q
    |||||||||| ||||||||||||||||||| | | | |||||||||||||| ||||| | ||  |||||| ||||  |||| |||| ||||||  ||||     
32349993 atcctttgtagcaagtctattcagaaagagccacgaaacaaaaatattaacttttaagggaatcgctttaagccataaaaattgatcaaaatctgcagtg 32350092  T
273 atgttattgtcaaccgttgttaagtaagaata 304  Q
    || ||| | || |||| |||||||||||||||    
32350093 atattagtatccaccgctgttaagtaagaata 32350124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 168 - 304
Target Start/End: Original strand, 21963522 - 21963658
Alignment:
168 agataatcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgccacgaaaaatgatgaaaatcct 267  Q
    |||| |||||||||| |||||| |||||||||||| | ||| |||||||||||||| ||||| |  || |||||| ||||  |||| |||| ||| ||      
21963522 agattatcctttgtagcaagtcgattcagaaagagcctccaaacaaaaatattaacttttaaagggaccgctttaagccataaaaattgatcaaactctg 21963621  T
268 cagtaatgttattgtcaaccgttgttaagtaagaata 304  Q
    |||| |  ||| | || ||||||||||||||||||||    
21963622 cagtgagattagtatccaccgttgttaagtaagaata 21963658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 168 - 304
Target Start/End: Original strand, 21964707 - 21964843
Alignment:
168 agataatcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgccacgaaaaatgatgaaaatcct 267  Q
    |||| |||||||||| |||||| |||||||||||| | ||| |||||||||||||| ||||| |  || |||||| ||||  |||| |||| ||| ||      
21964707 agattatcctttgtagcaagtcgattcagaaagagcctccaaacaaaaatattaacttttaaagggaccgctttaagccataaaaattgatcaaactctg 21964806  T
268 cagtaatgttattgtcaaccgttgttaagtaagaata 304  Q
    |||| |  ||| | || ||||||||||||||||||||    
21964807 cagtgagattagtatccaccgttgttaagtaagaata 21964843  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 174 - 247
Target Start/End: Original strand, 38938592 - 38938665
Alignment:
174 tcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgcca 247  Q
    |||||||||  |||||||||||||||||||||||| |||||||| ||||  ||||| | ||| |||||| ||||    
38938592 tcctttgtagtaagtctattcagaaagagacgccaaacaaaaatgttaatttttaagggaaccgctttaagcca 38938665  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 168 - 223
Target Start/End: Complemental strand, 27914709 - 27914654
Alignment:
168 agataatcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaac 223  Q
    |||| |||||||||| ||||||||||||||||||  || || ||||||||||||||    
27914709 agattatcctttgtagcaagtctattcagaaagaaccgtcaaacaaaaatattaac 27914654  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 57; Significance: 1e-23; HSPs: 14)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 150 - 322
Target Start/End: Original strand, 3514780 - 3514952
Alignment:
150 agaacatttctcttccacagataatcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgccacg 249  Q
    |||||||| ||||| |  |||| |||||||||| ||||||||||||||||||  ||||| |||||||||||||| ||||| |  || |||||| ||||      
3514780 agaacattcctcttgcgaagattatcctttgtagcaagtctattcagaaagaaccgccaaacaaaaatattaacttttaagggtaccgctttaagccata 3514879  T
250 aaaaatgatgaaaatcctcagtaatgttattgtcaaccgttgttaagtaagaatacgcagattgcactgtgta 322  Q
    |||| |||| ||||||  |||| |||||| |||| |||| ||||||||||||||| || || ||||| |||||    
3514880 aaaattgatcaaaatctgcagtgatgttagtgtccaccgctgttaagtaagaataagctgaatgcaccgtgta 3514952  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 174 - 322
Target Start/End: Original strand, 48547674 - 48547822
Alignment:
174 tcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgccacgaaaaatgatgaaaatcctcagtaa 273  Q
    ||||||||  |||||||||||||||||||||||||||||||||||||||||||||| | |||||||||| ||||  |||| |||| ||| ||  |||| |    
48547674 tcctttgttgcaagtctattcagaaagagacgccagacaaaaatattaacctttaatggaactgctttaagccataaaaattgattaaactctgcagtga 48547773  T
274 tgttattgtcaaccgttgttaagtaagaatacgcagattgcactgtgta 322  Q
    ||||   ||| ||||| ||||| |||||||| || || ||||| |||||    
48547774 tgttgaagtccaccgtcgttaaataagaataagctgaatgcaccgtgta 48547822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 168 - 316
Target Start/End: Original strand, 9819174 - 9819322
Alignment:
168 agataatcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgccacgaaaaatgatgaaaatcct 267  Q
    |||| |||||||||| |||||||||||||||| || ||||| ||| ||||||| || ||||| | ||| |||||| ||||  |||| |||| ||||||      
9819174 agattatcctttgtagcaagtctattcagaaaaagccgccaaacataaatattgacttttaagggaaccgctttaagccataaaaattgatcaaaatctg 9819273  T
268 cagtaatgttattgtcaaccgttgttaagtaagaatacgcagattgcac 316  Q
    |||| |||||| |||| |||| ||||||||||||||| ||||| |||||    
9819274 cagtgatgttagtgtccaccgctgttaagtaagaataagcagaatgcac 9819322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 174 - 304
Target Start/End: Original strand, 23603382 - 23603512
Alignment:
174 tcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgccacgaaaaatgatgaaaatcctcagtaa 273  Q
    ||||| ||| ||||||||||||||||||| ||||| |||||||| ||||| ||||| | ||| |||||| ||||  |||| |||| ||| ||| || | |    
23603382 tccttagtagcaagtctattcagaaagagtcgccaaacaaaaatgttaacttttaaaggaaccgctttaagccataaaaattgatcaaactccgcaatga 23603481  T
274 tgttattgtcaaccgttgttaagtaagaata 304  Q
    | |||||||| ||||||||||||||||||||    
23603482 tattattgtccaccgttgttaagtaagaata 23603512  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 174 - 301
Target Start/End: Complemental strand, 23571723 - 23571596
Alignment:
174 tcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgccacgaaaaatgatgaaaatcctcagtaa 273  Q
    ||||||||| |||||||||||||||||||||| || |||||||| ||||| ||||| | ||| |||||| ||||  |||| |||| ||| ||  |||| |    
23571723 tcctttgtagcaagtctattcagaaagagacgtcatacaaaaatgttaacttttaagggaaccgctttaagccataaaaattgatcaaactctacagtga 23571624  T
274 tgttattgtcaaccgttgttaagtaaga 301  Q
    ||||| |||| |||| ||||||||||||    
23571623 tgttagtgtccaccgctgttaagtaaga 23571596  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 174 - 304
Target Start/End: Original strand, 42462840 - 42462970
Alignment:
174 tcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgccacgaaaaatgatgaaaatcctcagtaa 273  Q
    ||||||||| |||||||||||||||||| |||||| |||||||| ||||| ||||| | | | | |||| ||||  |||| |||| ||| ||  ||||||    
42462840 tcctttgtagcaagtctattcagaaagaaacgccaaacaaaaatgttaacttttaagggagccgttttaagccataaaaattgatcaaactctgcagtaa 42462939  T
274 tgttattgtcaaccgttgttaagtaagaata 304  Q
    ||||  |||| ||||||||||| ||||||||    
42462940 tgttgatgtccaccgttgttaaataagaata 42462970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 174 - 247
Target Start/End: Original strand, 8595377 - 8595450
Alignment:
174 tcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgcca 247  Q
    ||||||||| ||||||||||||||||||||||||| |||||||| ||||| ||||| | ||| |||||| ||||    
8595377 tcctttgtagcaagtctattcagaaagagacgccaaacaaaaatgttaacttttaaaggaaccgctttaagcca 8595450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 177 - 241
Target Start/End: Original strand, 16664099 - 16664163
Alignment:
177 tttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgcttt 241  Q
    |||||| ||||||||||||||||||||||||| |||||||| |||||||| |||| ||| |||||    
16664099 tttgtagcaagtctattcagaaagagacgccaaacaaaaatgttaaccttcaacggaaccgcttt 16664163  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 177 - 241
Target Start/End: Complemental strand, 39632931 - 39632867
Alignment:
177 tttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgcttt 241  Q
    |||||| ||||||||||||||||||||||||| |||||||| |||||||| |||| ||| |||||    
39632931 tttgtagcaagtctattcagaaagagacgccaaacaaaaatgttaaccttcaacggaaccgcttt 39632867  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 153 - 241
Target Start/End: Original strand, 10754162 - 10754250
Alignment:
153 acatttctcttccacagataatcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgcttt 241  Q
    |||||||| || |||| || ||| |||||| |||||||||||| |||||||||||| ||||| || |||||||| |||| ||| |||||    
10754162 acatttcttttacacaaattatcttttgtagcaagtctattcataaagagacgccaaacaaagatgttaaccttcaacggaaccgcttt 10754250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 177 - 241
Target Start/End: Original strand, 52196409 - 52196473
Alignment:
177 tttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgcttt 241  Q
    |||||| ||||||||||||||||||| ||||| |||||||| |||||||| |||| ||| |||||    
52196409 tttgtagcaagtctattcagaaagaggcgccaaacaaaaatgttaaccttcaacggaaccgcttt 52196473  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 168 - 247
Target Start/End: Complemental strand, 17153915 - 17153836
Alignment:
168 agataatcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgcca 247  Q
    |||| |||||||||| |||||||||||| |||||| ||||| | |||||||||||| ||||| | ||| |||||| ||||    
17153915 agattatcctttgtagcaagtctattcataaagagccgccaaataaaaatattaacttttaatggaaccgctttaagcca 17153836  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 174 - 301
Target Start/End: Complemental strand, 42459405 - 42459278
Alignment:
174 tcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgccacgaaaaatgatgaaaatcctcagtaa 273  Q
    ||||||||| ||| |||||||||||| ||||| || |||||||| ||||||||||||| |||  | ||| ||||  | || || | |||||| ||||| |    
42459405 tcctttgtagcaattctattcagaaaaagacgtcaaacaaaaatgttaacctttaacggaacctccttaagccataagaattggttaaaatcttcagtga 42459306  T
274 tgttattgtcaaccgttgttaagtaaga 301  Q
    |||| ||||| |||| |||||| |||||    
42459305 tgttgttgtccaccgctgttaaataaga 42459278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 168 - 229
Target Start/End: Complemental strand, 53152193 - 53152132
Alignment:
168 agataatcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaa 229  Q
    |||| |||||||||| |||||| |||| ||||||| | ||| |||||||||||||| |||||    
53152193 agattatcctttgtagcaagtcgattctgaaagagcctccaaacaaaaatattaacttttaa 53152132  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 53; Significance: 3e-21; HSPs: 5)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 174 - 322
Target Start/End: Complemental strand, 26077828 - 26077680
Alignment:
174 tcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgccacgaaaaatgatgaaaatcctcagtaa 273  Q
    ||||||||| ||||||||||||||||||| ||||| |||||||||||||| ||||| |  || |||||| ||||  |||| |||| ||||||  |||| |    
26077828 tcctttgtagcaagtctattcagaaagagccgccaaacaaaaatattaacttttaagggtaccgctttaagccataaaaattgatcaaaatctgcagtga 26077729  T
274 tgttattgtcaaccgttgttaagtaagaatacgcagattgcactgtgta 322  Q
    ||||| |||| |||| ||||||| ||||||| || || ||||| |||||    
26077728 tgttagtgtccaccgctgttaagaaagaataagctgaatgcaccgtgta 26077680  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 153 - 241
Target Start/End: Complemental strand, 10801803 - 10801715
Alignment:
153 acatttctcttccacagataatcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgcttt 241  Q
    |||||||| || |||| || ||| |||||| ||||||||||||||||||||||||| |||||||| |||||||| |||| |||||||||    
10801803 acatttcttttacacaaattatcttttgtagcaagtctattcagaaagagacgccaaacaaaaatgttaaccttcaacggaactgcttt 10801715  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 184 - 322
Target Start/End: Complemental strand, 31423333 - 31423195
Alignment:
184 caagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgccacgaaaaatgatgaaaatcctcagtaatgttattgtc 283  Q
    |||||||||||||||||||||| ||||||||||||||||||||||| | ||| |||||| ||||  |||| |||| ||| ||  |||| |||||   | |    
31423333 caagtctattcagaaagagacgtcagacaaaaatattaacctttaagggaaccgctttaagccataaaaattgattaaactctgcagtgatgttgaagcc 31423234  T
284 aaccgttgttaagtaagaatacgcagattgcactgtgta 322  Q
     ||||||||||| |||||||| || || ||||| |||||    
31423233 caccgttgttaaataagaataagctgaatgcaccgtgta 31423195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 178 - 229
Target Start/End: Complemental strand, 26390340 - 26390289
Alignment:
178 ttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaa 229  Q
    ||||| |||||||||||||||||||||||||||||||||| |||||||||||    
26390340 ttgtagcaagtctattcagaaagagacgccagacaaaaatgttaacctttaa 26390289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 174 - 229
Target Start/End: Original strand, 29532477 - 29532532
Alignment:
174 tcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaa 229  Q
    ||||||||| |||||||||||||||||||||||||||||||||| ||||| |||||    
29532477 tcctttgtagcaagtctattcagaaagagacgccagacaaaaatgttaacatttaa 29532532  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0041 (Bit Score: 52; Significance: 1e-20; HSPs: 1)
Name: scaffold0041
Description:

Target: scaffold0041; HSP #1
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 174 - 301
Target Start/End: Original strand, 74418 - 74545
Alignment:
174 tcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgccacgaaaaatgatgaaaatcctcagtaa 273  Q
    ||||||||| ||||||||||||||||||||||||| |||||||| ||||| ||||| | ||| |||||| ||||  |||| |||| ||| ||  |||| |    
74418 tcctttgtagcaagtctattcagaaagagacgccaaacaaaaatgttaacttttaagggaaccgctttaagccataaaaattgatcaaactctgcagtga 74517  T
274 tgttattgtcaaccgttgttaagtaaga 301  Q
    ||||| |||| |||| ||||||||||||    
74518 tgttagtgtccaccgctgttaagtaaga 74545  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0032 (Bit Score: 51; Significance: 4e-20; HSPs: 1)
Name: scaffold0032
Description:

Target: scaffold0032; HSP #1
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 174 - 304
Target Start/End: Complemental strand, 58498 - 58368
Alignment:
174 tcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgccacgaaaaatgatgaaaatcctcagtaa 273  Q
    ||||||||| ||||||||||||||||||||||||| |||||||| ||||||||||| | ||| |||||| ||||  |||| |||| ||| ||  |||| |    
58498 tcctttgtagcaagtctattcagaaagagacgccaaacaaaaatgttaacctttaagggaaccgctttaagccataaaaattgattaaactctgcagtga 58399  T
274 tgttattgtcaaccgttgttaagtaagaata 304  Q
    ||||  |||| |||| |||||| ||||||||    
58398 tgttgatgtccaccgctgttaaataagaata 58368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0003 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: scaffold0003
Description:

Target: scaffold0003; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 174 - 265
Target Start/End: Complemental strand, 224828 - 224737
Alignment:
174 tcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgccacgaaaaatgatgaaaatc 265  Q
    ||||||||| |||||||||||||||| |||||||| |||||||| ||||||||||||| ||| || ||| ||||  |||| |||||||||||    
224828 tcctttgtagcaagtctattcagaaaaagacgccaaacaaaaatgttaacctttaacggaaccgccttaagccataaaaattgatgaaaatc 224737  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 46; Significance: 4e-17; HSPs: 9)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 174 - 247
Target Start/End: Original strand, 11266145 - 11266218
Alignment:
174 tcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgcca 247  Q
    ||||||||| ||||||||||||||||||||||||| |||||||||||||| ||||| | ||| |||||| ||||    
11266145 tcctttgtagcaagtctattcagaaagagacgccaaacaaaaatattaacttttaaaggaaccgctttaagcca 11266218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 174 - 247
Target Start/End: Original strand, 27891818 - 27891891
Alignment:
174 tcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgcca 247  Q
    ||||||||  |||||||||||||||||||| ||||||||||||||||||||||||| | ||| |||||| ||||    
27891818 tcctttgttgcaagtctattcagaaagagatgccagacaaaaatattaacctttaatggaaccgctttaagcca 27891891  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 177 - 241
Target Start/End: Original strand, 29322916 - 29322980
Alignment:
177 tttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgcttt 241  Q
    |||||| ||||||||||||||||||||||||| |||||||| |||||||| |||| |||||||||    
29322916 tttgtagcaagtctattcagaaagagacgccaaacaaaaatgttaaccttcaacggaactgcttt 29322980  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 174 - 231
Target Start/End: Original strand, 29150424 - 29150481
Alignment:
174 tcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacg 231  Q
    ||||||||| ||||||||||||| || |||| ||| ||||||||||||||||||||||    
29150424 tcctttgtagcaagtctattcaggaaaagacaccaaacaaaaatattaacctttaacg 29150481  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 168 - 304
Target Start/End: Complemental strand, 5825077 - 5824941
Alignment:
168 agataatcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgccacgaaaaatgatgaaaatcct 267  Q
    |||| |||||||||| |||||| |||||||||||| | ||| |||||||||||||| ||||| |  || |||||| ||||  |||| |||| ||| ||      
5825077 agattatcctttgtagcaagtcgattcagaaagagcctccaaacaaaaatattaacttttaaagggaccgctttaagccataaaaattgatcaaactctg 5824978  T
268 cagtaatgttattgtcaaccgttgttaagtaagaata 304  Q
    |||| |  ||| | || ||||||||||||||||||||    
5824977 cagtgagattagtatccaccgttgttaagtaagaata 5824941  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 173 - 316
Target Start/End: Complemental strand, 31962775 - 31962632
Alignment:
173 atcctttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctttaacgaaactgctttatgccacgaaaaatgatgaaaatcctcagta 272  Q
    |||||||||| |||||||||||||| ||||| |||| ||||| || ||||||||||||| |||  ||||  ||||  |||| |||  |||||| ||||      
31962775 atcctttgtagcaagtctattcagatagagatgccaaacaaatatgttaacctttaacggaaccacttttagccataaaaattgagcaaaatcttcagag 31962676  T
273 atgttattgtcaaccgttgttaagtaagaatacgcagattgcac 316  Q
    |||||| |||| || |  ||||| |||||||| || ||||||||    
31962675 atgttagtgtccactgccgttaaataagaataagctgattgcac 31962632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 177 - 226
Target Start/End: Original strand, 8896369 - 8896418
Alignment:
177 tttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctt 226  Q
    |||||| ||||||||||||||||||||||||| ||||  || ||||||||    
8896369 tttgtagcaagtctattcagaaagagacgccaaacaactatgttaacctt 8896418  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 177 - 226
Target Start/End: Original strand, 38931892 - 38931941
Alignment:
177 tttgtatcaagtctattcagaaagagacgccagacaaaaatattaacctt 226  Q
    |||||| |||||||||||||||||||| |||| ||||| || ||||||||    
38931892 tttgtagcaagtctattcagaaagagatgccaaacaaatatgttaacctt 38931941  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 168 - 220
Target Start/End: Complemental strand, 6678684 - 6678632
Alignment:
168 agataatcctttgtatcaagtctattcagaaagagacgccagacaaaaatatt 220  Q
    |||| |||||||||| |||||| |||||||||||| | ||| |||||||||||    
6678684 agattatcctttgtagcaagtcgattcagaaagagcctccaaacaaaaatatt 6678632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 148943 times since January 2019
Visitors: 1515