View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1565_low_9 (Length: 387)

Name: NF1565_low_9
Description: NF1565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1565_low_9
NF1565_low_9
[»] chr7 (2 HSPs)
chr7 (1-363)||(33777163-33777525)
chr7 (3-301)||(33774587-33774888)
[»] chr8 (7 HSPs)
chr8 (1-344)||(10657513-10657853)
chr8 (18-327)||(10707449-10707755)
chr8 (90-342)||(10634024-10634273)
chr8 (1-264)||(10693636-10693896)
chr8 (18-280)||(10698240-10698499)
chr8 (1-278)||(10690290-10690564)
chr8 (250-343)||(10693909-10694002)
[»] chr2 (2 HSPs)
chr2 (1-278)||(15240269-15240546)
chr2 (1-264)||(15246621-15246877)


Alignment Details
Target: chr7 (Bit Score: 347; Significance: 0; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 347; E-Value: 0
Query Start/End: Original strand, 1 - 363
Target Start/End: Complemental strand, 33777525 - 33777163
Alignment:
1 ccccaattgtttgggaggaacatcaacaccaaataaactattgaaagtgaaccaaacacttccatgagtgtatcaattcttgttgtggtaaacttaatct 100  Q
    |||||||||||||| |||||||| ||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
33777525 ccccaattgtttggaaggaacattaacaccaaagaaactattgaaagtgaaccaaacacttctatgagtgtatcaattcttgttgtggtaaacttaatct 33777426  T
101 taatccaaaagaccaaacaatatagtagaaagctagcaatagagacaaacattgtctttggatggacatgaaatgcagtgggattatctggataactaat 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33777425 taatccaaaagaccaaacaatatagtagaaagctagcaatagagacaaacattgtctttggatggacatgaaatgcagtgggattatctggataactaat 33777326  T
201 ttgaaggaaaccaatgagtacaaagaaaatgaaggccataaggccatgaaaaggattggtttctacacccatgatgttataaacattaacaacactcaca 300  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33777325 ttgaaggaaaccaatgagtacaaagaaaatgaaggccataaggccatgaaaaggattggtttctacacccatgatgttataaacattaacaacactcaca 33777226  T
301 atattgattgtcacttcatgaccttgattaaaactggatcttggtctcataacactagccatg 363  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33777225 atattgattgtcacttcatgaccttgattaaaactggatcttggtctcataacactagccatg 33777163  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 3 - 301
Target Start/End: Complemental strand, 33774888 - 33774587
Alignment:
3 ccaattgtttgggaggaacatc----aacaccaaataaactattgaaagtgaaccaaacacttccatgagtgtatcaattcttgttgtggtaaacttaat 98  Q
    ||||||||||||||||||||||    ||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||    
33774888 ccaattgtttgggaggaacatcgatcaacaccaaagaaactattgaaagtgagccaaacacttccatgagtgtatcaattcttgtcgtggtaaacttaat 33774789  T
99 cttaatccaaaagaccaaacaatatagtagaaa-gctagcaatagagacaaacattgtctttggatggacatgaaatgcagtgggattatctggataact 197  Q
     |||||||| |||||||| |||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33774788 attaatccagaagaccaagcaatatagtagaaaagctagcaatagtgacaaacattgtctttggatggacatgaaatgcagtgggattatctggataact 33774689  T
198 aatttgaaggaaaccaatgagtacaaagaaaatgaaggccataaggccatgaaaaggattggtttctacacccatgatgttataaacattaacaacactc 297  Q
    |||||||||||||||||||||| |  ||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||| |||||     
33774688 aatttgaaggaaaccaatgagtcc--agaaaatgaaggccataaggccatgaaaatgattggtttctactcccatgatgttataaacattaactacacta 33774591  T
298 acaa 301  Q
    ||||    
33774590 acaa 33774587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 190; Significance: 1e-103; HSPs: 7)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 344
Target Start/End: Original strand, 10657513 - 10657853
Alignment:
1 ccccaattgtttgggaggaacatcaacaccaaataaactattgaaagtgaaccaaacacttccatgagtgtatcaattcttgttgtggtaaacttaatct 100  Q
    ||||| |||||||||| |||||||||||||||| ||| ||||||||||||||||||| |||||||||| ||||||| |||| | |    |||||||| ||    
10657513 ccccatttgtttgggatgaacatcaacaccaaagaaattattgaaagtgaaccaaacgcttccatgagggtatcaagtcttatagc---aaacttaagct 10657609  T
101 taatccaaaagaccaaacaatatagtagaaagctagcaatagagacaaacattgtctttggatggacatgaaatgcagtgggattatctggataactaat 200  Q
    ||||||||||| | || |||||||||||||||||||| | |||||  | |||||||||||||||| | ||||||||||||||||||| ||||||||||||    
10657610 taatccaaaaggcaaagcaatatagtagaaagctagctacagagagtagcattgtctttggatgggcttgaaatgcagtgggattatttggataactaat 10657709  T
201 ttgaaggaaaccaatgagtacaaagaaaatgaaggccataaggccatgaaaaggattggtttctacacccatgatgttataaacattaacaacactcaca 300  Q
    |||||||||||||||||| |||||||||| ||||| |||||||||||| | ||||||||||||||| |||||||||||||||||||||||||||||  ||    
10657710 ttgaaggaaaccaatgaggacaaagaaaaggaaggtcataaggccatggagaggattggtttctactcccatgatgttataaacattaacaacactggca 10657809  T
301 atattgattgtcacttcatgaccttgattaaaactggatcttgg 344  Q
    | ||| || ||||| |||||||||||||||||| ||||||||||    
10657810 acatttatggtcacctcatgaccttgattaaaagtggatcttgg 10657853  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 168; E-Value: 6e-90
Query Start/End: Original strand, 18 - 327
Target Start/End: Original strand, 10707449 - 10707755
Alignment:
18 gaacatcaacaccaaataaactattgaaagtgaaccaaacacttccatgagtgtatcaattcttgttgtggtaaacttaatcttaatccaaaagaccaaa 117  Q
    |||||||||||||||| ||||||||||||| |||||||||||||||||||| |||||||  |||||||    |||| ||| ||||||||||||| | |||    
10707449 gaacatcaacaccaaagaaactattgaaagggaaccaaacacttccatgagggtatcaacccttgttgc---aaacataagcttaatccaaaaggcaaaa 10707545  T
118 caatatagtagaaagctagcaatagagacaaacattgtctttggatggacatgaaatgcagtgggattatctggataactaatttgaaggaaaccaatga 217  Q
    |||||||||||||||||||||| |||||  | |||||| ||||||||||  ||||||||||||||||||||||||||| ||||||| |||||| ||| ||    
10707546 caatatagtagaaagctagcaacagagattatcattgtttttggatggatttgaaatgcagtgggattatctggataagtaatttggaggaaagcaagga 10707645  T
218 gtacaaagaaaatgaaggccataaggccatgaaaaggattggtttctacacccatgatgttataaacattaacaacactcacaatattgattgtcacttc 317  Q
    ||||||||||||||||||||||||||| ||| | ||| ||||||||||| ||||||||||| ||||||||||||||||| |||| ||| || ||||||||    
10707646 gtacaaagaaaatgaaggccataaggctatgtagagggttggtttctactcccatgatgttgtaaacattaacaacacttacaacatttatggtcacttc 10707745  T
318 atgaccttga 327  Q
    ||||| ||||    
10707746 atgactttga 10707755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 90 - 342
Target Start/End: Original strand, 10634024 - 10634273
Alignment:
90 aaacttaatcttaatccaaaagaccaaacaatatagtagaaagctagcaatagagacaaacattgtctttggatggacatgaaatgcagtgggattatct 189  Q
    |||||||||||||||||||||| |||| |||||||||| ||| ||||| ||||||||||||||||||||||||||||| | ||| |  || ||||| |||    
10634024 aaacttaatcttaatccaaaaggccaagcaatatagtaaaaaactagccatagagacaaacattgtctttggatggacttcaaacgaggttggattttct 10634123  T
190 ggataactaatttgaaggaaaccaatgagtacaaagaaaatgaaggccataaggccatgaaaaggattggtttctacacccatgatgttataaacattaa 289  Q
    ||||| | |||||| |||||||||||||||||||| |||||||||||||||||| |||||||||||||| ||||||| ||| || ||| || ||||||||    
10634124 ggatatcgaatttggaggaaaccaatgagtacaaaaaaaatgaaggccataaggacatgaaaaggattgttttctactcccttggtgtcatgaacattaa 10634223  T
290 caacactcacaatattgattgtcacttcatgaccttgattaaaactggatctt 342  Q
    |||| |   | ||||||||||||||||||  ||||||||||||||| ||||||    
10634224 caactc---ctatattgattgtcacttcagaaccttgattaaaacttgatctt 10634273  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 118; E-Value: 4e-60
Query Start/End: Original strand, 1 - 264
Target Start/End: Original strand, 10693636 - 10693896
Alignment:
1 ccccaattgtttgggaggaacatcaacaccaaataaactattgaaagtgaaccaaacacttccatgagtgtatcaattcttgttgtggtaaacttaatct 100  Q
    |||||||||| ||||| |||||||| ||||||| ||||||||||||| |||||||||||||||||||  |||||||  || ||||    |||||| | ||    
10693636 ccccaattgtgtgggaagaacatcatcaccaaagaaactattgaaagggaaccaaacacttccatgaaggtatcaaccctagttgc---aaacttgagct 10693732  T
101 taatccaaaagaccaaacaatatagtagaaagctagcaatagagacaaacattgtctttggatggacatgaaatgcagtgggattatctggataactaat 200  Q
    ||||||||||| | ||  |||||| |||||||||||||| |||||  | |||||||||||||||||  ||||||||| |||| |||||||||||||| ||    
10693733 taatccaaaaggcaaaggaatatattagaaagctagcaacagagagtatcattgtctttggatggatttgaaatgcactgggtttatctggataactgat 10693832  T
201 ttgaaggaaaccaatgagtacaaagaaaatgaaggccataaggccatgaaaaggattggtttct 264  Q
    ||| |||||||||| ||||||||||||| ||||||||||||| | ||||| |||||||||||||    
10693833 ttggaggaaaccaaggagtacaaagaaagtgaaggccataagacaatgaagaggattggtttct 10693896  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 18 - 280
Target Start/End: Original strand, 10698240 - 10698499
Alignment:
18 gaacatcaacaccaaataaactattgaaagtgaaccaaacacttccatgagtgtatcaattcttgttgtggtaaacttaatcttaatccaaaagaccaaa 117  Q
    |||||||||||||||| ||| ||||||||| |||||||||||||||||||| |||||||  ||||||||   |||||||| ||||||||||||| |||||    
10698240 gaacatcaacaccaaagaaattattgaaagggaaccaaacacttccatgagggtatcaacccttgttgt---aaacttaagcttaatccaaaaggccaaa 10698336  T
118 caatatagtagaaagctagcaatagagacaaacattgtctttggatggacatgaaatgcagtgggattatctggataactaatttgaaggaaaccaatga 217  Q
    |||||||| ||||| ||||||||||| || ||| || ||||||||||||  |||||||  || ||||| ||||| || |||||||| |||||||||| ||    
10698337 caatataggagaaaactagcaatagacactaacgttatctttggatggatttgaaatggggtaggattttctgggtatctaatttggaggaaaccaagga 10698436  T
218 gtacaaagaaaatgaaggccataaggccatgaaaaggattggtttctacacccatgatgttat 280  Q
    ||||||||||||| ||||| | |||||||||   |||||| ||||| |  |||||||||||||    
10698437 gtacaaagaaaataaaggctacaaggccatgttgaggattagtttccattcccatgatgttat 10698499  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 1 - 278
Target Start/End: Original strand, 10690290 - 10690564
Alignment:
1 ccccaattgtttgggaggaacatcaacaccaaataaactattgaaagtgaaccaaacacttccatgagtgtatcaattcttgttgtggtaaacttaatct 100  Q
    |||||||| | |||||| ||||||||||||||  ||| || |||||||||||||||||||||||  |  |||||||  ||||| |    |||||||| ||    
10690290 ccccaattttctgggagcaacatcaacaccaatgaaattaatgaaagtgaaccaaacacttccaacaaggtatcaacccttgtagc---aaacttaagct 10690386  T
101 taatccaaaagaccaaacaatatagtagaaagctagcaatagagacaaacattgtctttggatggacatgaaatgcagtgggattatctggataactaat 200  Q
    |||||   ||| |||| |||||||||||||||||||||||||| || ||| |||||||||||||||| ||||| |  || ||||| |||||||| ||||     
10690387 taatcatgaaggccaagcaatatagtagaaagctagcaatagataccaacgttgtctttggatggacttgaaaaggggtaggattttctggatatctaac 10690486  T
201 ttgaaggaaaccaatgagtacaaagaaaatgaaggccataaggccatgaaaaggattggtttctacacccatgatgtt 278  Q
    ||| |||||||||| ||||||||||||||||||||| | |||||||||   |||||| |||||||| |||||||||||    
10690487 ttggaggaaaccaaggagtacaaagaaaatgaaggctacaaggccatgttgaggattagtttctactcccatgatgtt 10690564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 250 - 343
Target Start/End: Original strand, 10693909 - 10694002
Alignment:
250 aaaggattggtttctaca---cccatgatgttataaacattaacaacactcacaatattgattgtcacttcatgaccttgattaaaactggatcttg 343  Q
    |||||||||||||||||    ||||||||||||||||||||||||   ||||||| ||| || ||||||||||||| | |||||||| |||||||||    
10693909 aaaggattggtttctactactcccatgatgttataaacattaaca---ctcacaacatttatggtcacttcatgacttcgattaaaattggatcttg 10694002  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 114; Significance: 1e-57; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 1 - 278
Target Start/End: Complemental strand, 15240546 - 15240269
Alignment:
1 ccccaattgtttgggaggaacatcaacaccaaataaactattgaaagtgaaccaaacacttccatgagtgtatcaattcttgttgtggtaaacttaatct 100  Q
    |||||||||| ||||| ||||||||| |||||| ||| ||||||||| |||||||||||||||||||| |||||||| ||||||||   ||| ||||  |    
15240546 ccccaattgtgtgggaagaacatcaaaaccaaagaaattattgaaagggaaccaaacacttccatgagggtatcaatccttgttgtatcaaatttaagtt 15240447  T
101 taatccaaaagaccaaacaatatagtagaaagctagcaatagagacaaacattgtctttggatggacatgaaatgcagtgggattatctggataactaat 200  Q
    ||| ||||||  | ||| |||||||||||||||||||||||||||| |||||||||||||||||||  |||||  | |||||||||||||||||||  ||    
15240446 taacccaaaatgctaaagaatatagtagaaagctagcaatagagactaacattgtctttggatggagttgaaagactgtgggattatctggataacagat 15240347  T
201 ttgaaggaaaccaatgagtacaaagaaaatgaaggccataaggccatgaaaaggattggtttctacacccatgatgtt 278  Q
    ||| || ||||| || || ||| | ||||||||||||| ||| ||||||| || ||||||| |||  |||||||||||    
15240346 ttggagaaaacctataagcacataaaaaatgaaggccacaagaccatgaagagaattggttgctattcccatgatgtt 15240269  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 84; E-Value: 8e-40
Query Start/End: Original strand, 1 - 264
Target Start/End: Complemental strand, 15246877 - 15246621
Alignment:
1 ccccaattgtttgggaggaacatcaacaccaaataaactattgaaagtgaaccaaacacttccatgagtgtatcaattcttgttgtggtaaacttaatct 100  Q
    |||||||| ||||||| |||||||||||||||| ||| ||||||||| ||||||||||||||| | || |||||||  ||| |   || ||| ||||  |    
15246877 ccccaattctttgggaagaacatcaacaccaaagaaattattgaaagcgaaccaaacacttccttaagggtatcaagccttct---ggcaaatttaagtt 15246781  T
101 taatccaaaagaccaaacaatatagtagaaagctagcaatagagacaaacattgtctttggatggacatgaaatgcagtgggattatctggataactaat 200  Q
    ||| || |||  |||||||||||||||||||||||||||||||||| |||||||||||||||| |   ||||| |  ||||||||||||||||| |||||    
15246780 taaccctaaaagccaaacaatatagtagaaagctagcaatagagactaacattgtctttggattg--ttgaaaggttgtgggattatctggatagctaat 15246683  T
201 ttgaaggaaaccaatgagtacaaagaaaatgaaggccataaggccatgaaaaggattggtttct 264  Q
    | |  |||||||  |||||||| | ||||  ||||||| | ||||||||| |||||||||||||    
15246682 tcg--ggaaacctctgagtacacaaaaaaataaggccacagggccatgaagaggattggtttct 15246621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 141973 times since January 2019
Visitors: 1479