View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1613-INSERTION-4 (Length: 709)

Name: NF1613-INSERTION-4
Description: NF1613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1613-INSERTION-4
NF1613-INSERTION-4
[»] chr3 (2 HSPs)
chr3 (8-709)||(47269106-47269807)
chr3 (393-512)||(47260601-47260719)


Alignment Details
Target: chr3 (Bit Score: 672; Significance: 0; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 672; E-Value: 0
Query Start/End: Original strand, 8 - 709
Target Start/End: Complemental strand, 47269807 - 47269106
Alignment:
8 gaaatatctttatcgtagctaattattggttgcaaatttgcaactataaattaattattatgattaggtacatcttacaaaaactgtagatgtagatgga 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47269807 gaaatatctttatcgtagctaattattggttgcaaatttgcaactataaattaattattatgattaggtacatcttacaaaaactgtagatgtagatgga 47269708  T
108 tttattgctggaactacagagaatgcattaggctggttttctcagggagataccaatgatcagattctaaactttgccaatgcttacaacccttctcctc 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47269707 tttattgctggaactacagagaatgcattaggctggttttctcagggagataccaatgatcagattctaaactttgccaatgcttacaacccttctcctc 47269608  T
208 tcaggtactttttattgccattgattcgaytgtacattccaagtgaatttgtatcaaattgtttattgctcttatttctgaatatagtgatcaccaatca 307  Q
    ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
47269607 tcaggtactttttattgccattgattcgattgtacattccaagtgaatttgtatcaaattgtttattgctcttatttctgaatacagtgatcaccaatca 47269508  T
308 ctgagtactgttgttgatatggtaacgccaacttcgacccttctgaactctgcaaacgtcgatcacaattgtcaaattagttccagggatgctgcagagg 407  Q
    |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
47269507 ctgagtactgttgtcgatatggtaacgccaacttcgacccttctgaactctgcaaacgtcgatcacaattgtcaaattagtcccagggatgctgcagagg 47269408  T
408 ctgacattagtaatacactaagtactcagtttggacaagttatggacaccagtttgtcttcttgggagcacctccatcaattaggtacttaattgaataa 507  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
47269407 ctgacattagtaatacactaagtactcagtttggacaagttatggacaccagtttgtcctcttgggagcacctccatcaattaggtacttaattgaataa 47269308  T
508 attccaagtataattaactgtgtttgtgctgtaacttgatttgataatgcacattagttgaataaataattactgaaaatttactttttatttggtattt 607  Q
    |||||||||||||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47269307 attccaagtataattaactgtagttgtgctgtaacttgatttgataatgcacattagttgaataaataattactgaaaatttactttttatttggtattt 47269208  T
608 cagtttgatatattgatgataagattgtcataaaactaatagttcccaagtgtagttttggagtcgttgttttgtaatgaaatttgtacactgatgtttg 707  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
47269207 cagtttgatatattgatgataagattgtcataaaactaatagttcccaagtgtagttttggagtcattgttttgtaatgaaatttgtacactgatgtttg 47269108  T
708 aa 709  Q
    ||    
47269107 aa 47269106  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 393 - 512
Target Start/End: Complemental strand, 47260719 - 47260601
Alignment:
393 gggatgctgcagaggctgacattagtaatacactaagtactcagtttggacaagttatggacaccagtttgtcttcttgggagcacctccatcaattagg 492  Q
    |||||| ||||||||||||||| | || || | ||||| ||||||||||||||| ||| ||||||| | | ||  ||||||||||| ||||||| | | |    
47260719 gggatggtgcagaggctgacatcaatagtaaagtaagtgctcagtttggacaagctatagacaccaatatatc-ccttgggagcacttccatcattaaag 47260621  T
493 tacttaattgaataaattcc 512  Q
    |||||| ||||||| |||||    
47260620 tacttacttgaatatattcc 47260601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 136812 times since January 2019
Visitors: 1443