View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1613-INSERTION-5 (Length: 678)

Name: NF1613-INSERTION-5
Description: NF1613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1613-INSERTION-5
NF1613-INSERTION-5
[»] chr2 (2 HSPs)
chr2 (125-678)||(42069962-42070517)
chr2 (8-100)||(42070533-42070623)


Alignment Details
Target: chr2 (Bit Score: 480; Significance: 0; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 480; E-Value: 0
Query Start/End: Original strand, 125 - 678
Target Start/End: Complemental strand, 42070517 - 42069962
Alignment:
125 agtagaattgattttgtgaaaaatgattccaacttaaa-gttatattttatagctcattgtacaactcactattatatttatgtctccaaattaaatact 223  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42070517 agtagaattgattttgtgaaaaatgattccaacttaaaagttatattttatagctcattgtacaactcactattatatttatgtctccaaattaaatact 42070418  T
224 accgttattctaaaaatgtgtttaatgattacaatcacttattttgaaaacttattgaggtttcttattagtaggcattttaaaattgattgaaagaaac 323  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42070417 accgttattctaaaaatgtgtttaatgattacaatcacttattttgaaaacttattgaggtttcttattagtaggcattttaaaattgattgaaagaaac 42070318  T
324 gtttgcataaactatagtacaattctaa-cattgtttgtatctttgatgcaaggaaagaactggtaagaatattctctctatattaaatgcctaacgcac 422  Q
    |||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42070317 gtttgcataaactatagtacaattctaaacattgtt-gtatctttgatgcaaggaaagaactggtaagaatattctctctatattaaatgcctaacgcac 42070219  T
423 gaactataaccaatcatggttgttattttttccccatgcaaatgcgatgacccttcatggtgtttaagattgtaaactcatgcatcgaaccaaaggtcac 522  Q
    |||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||    
42070218 gaactacaaccaatcatggttgttattttttccccatgcaaatgcggtgacccttcatggtgtttaagattgtaaactcattcatcgaaccaaaggtcac 42070119  T
523 tgttaatttcaaaatagagaaaccaattatcaaatccatgaagtgaaaaaagatcaattccacgaagtgaataaatattcaatttgatctttgatatcgt 622  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
42070118 tgttaatttcaaaatagagaaaccaattatcaaatccatgaagtgaaaaaagataaattccacgaagtgaataaatattcaatttgatctttgatatcgt 42070019  T
623 agaccaacggaatgnnnnnnnt-ataatcatcgagtcgtgcaagggtttaggttttc 678  Q
    ||| | ||||||||       | ||||||||||||||||||||||||||||||||||    
42070018 agaactacggaatgaaaaaaataataatcatcgagtcgtgcaagggtttaggttttc 42069962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 8 - 100
Target Start/End: Complemental strand, 42070623 - 42070533
Alignment:
8 ttcacatgagtcaatcatagattgaggaccaattaaaattgtgtttggttccaccttaaaatgtcaacattgatattagatgcatgtaattaa 100  Q
    ||||||||||| |||||| ||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
42070623 ttcacatgagt-aatcat-gattgaggaccaattaagattgtgtttggttccactttaaaatgtcaacattgatattagatgcatgtaattaa 42070533  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 137096 times since January 2019
Visitors: 1444