View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1613-INSERTION-6 (Length: 564)

Name: NF1613-INSERTION-6
Description: NF1613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1613-INSERTION-6
NF1613-INSERTION-6
[»] chr2 (9 HSPs)
chr2 (151-320)||(24562728-24562897)
chr2 (422-564)||(24562471-24562610)
chr2 (7-114)||(24563113-24563221)
chr2 (521-552)||(18534354-18534385)
chr2 (521-552)||(19658474-19658505)
chr2 (521-564)||(20629015-20629058)
chr2 (521-552)||(22137434-22137465)
chr2 (521-552)||(24088980-24089011)
chr2 (521-552)||(36892369-36892400)
[»] chr6 (6 HSPs)
chr6 (511-564)||(21930411-21930464)
chr6 (521-552)||(18422263-18422294)
chr6 (521-552)||(19852799-19852830)
chr6 (521-552)||(23220226-23220257)
chr6 (521-552)||(34965474-34965505)
chr6 (521-551)||(35017313-35017343)
[»] chr3 (11 HSPs)
chr3 (511-564)||(15989497-15989550)
chr3 (521-563)||(16183664-16183705)
chr3 (522-564)||(38377413-38377455)
chr3 (521-563)||(41660139-41660180)
chr3 (521-552)||(5229686-5229717)
chr3 (521-552)||(6148466-6148497)
chr3 (521-552)||(9592359-9592390)
chr3 (521-564)||(11883921-11883963)
chr3 (521-552)||(14523015-14523046)
chr3 (521-552)||(33370972-33371003)
chr3 (521-551)||(11813363-11813393)
[»] chr1 (10 HSPs)
chr1 (511-564)||(77630-77683)
chr1 (521-563)||(2422732-2422773)
chr1 (521-552)||(5471993-5472024)
chr1 (521-552)||(5769823-5769854)
chr1 (521-552)||(21193693-21193724)
chr1 (521-552)||(22145001-22145032)
chr1 (521-552)||(22407903-22407934)
chr1 (521-552)||(37235570-37235601)
chr1 (521-552)||(41213276-41213307)
chr1 (521-552)||(49966111-49966142)
[»] scaffold0601 (1 HSPs)
scaffold0601 (511-564)||(2576-2629)
[»] chr7 (7 HSPs)
chr7 (511-564)||(21676631-21676684)
chr7 (521-552)||(142096-142127)
chr7 (521-552)||(9058241-9058272)
chr7 (521-552)||(15824113-15824144)
chr7 (521-552)||(20587219-20587250)
chr7 (521-552)||(44863671-44863702)
chr7 (523-552)||(8565187-8565216)
[»] chr4 (7 HSPs)
chr4 (511-563)||(54365173-54365225)
chr4 (521-563)||(5372297-5372338)
chr4 (521-552)||(10239046-10239077)
chr4 (521-552)||(41257961-41257992)
chr4 (521-551)||(53909441-53909471)
chr4 (511-552)||(17377049-17377090)
chr4 (521-549)||(33738691-33738719)
[»] chr8 (13 HSPs)
chr8 (521-563)||(23153407-23153448)
chr8 (521-554)||(22312194-22312227)
chr8 (521-552)||(16416770-16416801)
chr8 (521-552)||(19994811-19994842)
chr8 (521-552)||(22498911-22498942)
chr8 (521-552)||(24719086-24719117)
chr8 (521-552)||(25120972-25121003)
chr8 (521-552)||(33170789-33170820)
chr8 (521-552)||(41244161-41244192)
chr8 (522-552)||(25294527-25294557)
chr8 (522-552)||(25756516-25756546)
chr8 (511-552)||(24238059-24238100)
chr8 (523-552)||(33612669-33612698)
[»] scaffold0786 (2 HSPs)
scaffold0786 (521-552)||(215-246)
scaffold0786 (521-552)||(5270-5301)
[»] scaffold0673 (1 HSPs)
scaffold0673 (521-552)||(3716-3747)
[»] scaffold0396 (1 HSPs)
scaffold0396 (521-552)||(13799-13830)
[»] scaffold0390 (1 HSPs)
scaffold0390 (521-552)||(3803-3834)
[»] scaffold0292 (1 HSPs)
scaffold0292 (521-552)||(18111-18142)
[»] scaffold0243 (1 HSPs)
scaffold0243 (521-552)||(3904-3935)
[»] scaffold0190 (1 HSPs)
scaffold0190 (521-552)||(8604-8635)
[»] scaffold0037 (1 HSPs)
scaffold0037 (521-552)||(26425-26456)
[»] scaffold0022 (1 HSPs)
scaffold0022 (521-552)||(130413-130444)
[»] scaffold0021 (2 HSPs)
scaffold0021 (521-552)||(76813-76844)
scaffold0021 (521-552)||(138415-138446)
[»] scaffold0016 (1 HSPs)
scaffold0016 (521-552)||(163861-163892)
[»] scaffold0011 (1 HSPs)
scaffold0011 (521-552)||(256569-256600)
[»] scaffold0004 (2 HSPs)
scaffold0004 (521-552)||(84946-84977)
scaffold0004 (521-563)||(26084-26125)
[»] chr5 (3 HSPs)
chr5 (521-552)||(5452441-5452472)
chr5 (521-552)||(20455706-20455737)
chr5 (521-552)||(21615540-21615571)
[»] scaffold0269 (1 HSPs)
scaffold0269 (521-551)||(3478-3508)
[»] scaffold0171 (1 HSPs)
scaffold0171 (521-551)||(31264-31294)
[»] scaffold0116 (1 HSPs)
scaffold0116 (521-551)||(28287-28317)
[»] scaffold0049 (1 HSPs)
scaffold0049 (521-551)||(31050-31080)
[»] scaffold0039 (1 HSPs)
scaffold0039 (521-551)||(20916-20946)
[»] scaffold0193 (1 HSPs)
scaffold0193 (521-550)||(3283-3312)


Alignment Details
Target: chr2 (Bit Score: 146; Significance: 1e-76; HSPs: 9)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 146; E-Value: 1e-76
Query Start/End: Original strand, 151 - 320
Target Start/End: Complemental strand, 24562897 - 24562728
Alignment:
151 ttttttctagtcaattgacctaagcgaccctatgcagatgttgacacgtgggcaggaaaataccatatggtctagaatgaaaatatcttaaaatagaata 250  Q
    |||||||  |||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||| ||    
24562897 ttttttccggtcaattgacctaagcgaccctatgcagatgttgacacgtgggctggaaaacaccatatggtctagaatgaaaatatcttaaaatagacta 24562798  T
251 ttgataagatgttcacgtgaaacaacaaagcatgcagattttttggttggaaaatgatatttgaagtgac 320  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
24562797 ttgataagatgttcacgtgaaacaacaaaacatgcagattttttggttggaaaatgatatttgaagtgac 24562728  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 105; E-Value: 4e-52
Query Start/End: Original strand, 422 - 564
Target Start/End: Complemental strand, 24562610 - 24562471
Alignment:
422 atacatatcgtttgatgtcccataaattatcctaaaatggttgtttaaataacacacttcttttttacttgagagtttatttgagagtttatacacaaga 521  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |    ||||||||||||||||||||| | |    
24562610 atacatattgtttgatgtcccataaattatcctaaaatggttgtttaaataacacacttcttttttactcg---ttttatttgagagtttatacacgaca 24562514  T
522 catatatgcatgtggtaccaaatcacctcaaagatcgtcacct 564  Q
    ||||| |||||||||||||||||||||||||||||||||||||    
24562513 catatttgcatgtggtaccaaatcacctcaaagatcgtcacct 24562471  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 97; E-Value: 2e-47
Query Start/End: Original strand, 7 - 114
Target Start/End: Complemental strand, 24563221 - 24563113
Alignment:
7 aagatttccatctgccatggaataaatttcttgcatttcttgt-tctcagattttgttctgtattttgtagaattcgtgtgtgagtggtttgaggaatag 105  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
24563221 aagatttccatctgccatggaataaatttcttgcatttcttgtgtctcagattttgttctgtattttttagaattcgtgtgtgagtggtttgaggaatag 24563122  T
106 tggaaagta 114  Q
    |||||||||    
24563121 tggaaagta 24563113  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 521 - 552
Target Start/End: Original strand, 18534354 - 18534385
Alignment:
521 acatatatgcatgtggtaccaaatcacctcaa 552  Q
    ||||||||||||||||||||||||||||||||    
18534354 acatatatgcatgtggtaccaaatcacctcaa 18534385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 521 - 552
Target Start/End: Original strand, 19658474 - 19658505
Alignment:
521 acatatatgcatgtggtaccaaatcacctcaa 552  Q
    ||||||||||||||||||||||||||||||||    
19658474 acatatatgcatgtggtaccaaatcacctcaa 19658505  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 521 - 564
Target Start/End: Complemental strand, 20629058 - 20629015
Alignment:
521 acatatatgcatgtggtaccaaatcacctcaaagatcgtcacct 564  Q
    ||||||||||||||||||||||||| ||  ||||||||||||||    
20629058 acatatatgcatgtggtaccaaatctccaaaaagatcgtcacct 20629015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 521 - 552
Target Start/End: Complemental strand, 22137465 - 22137434
Alignment:
521 acatatatgcatgtggtaccaaatcacctcaa 552  Q
    ||||||||||||||||||||||||||||||||    
22137465 acatatatgcatgtggtaccaaatcacctcaa 22137434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 521 - 552
Target Start/End: Complemental strand, 24089011 - 24088980
Alignment:
521 acatatatgcatgtggtaccaaatcacctcaa 552  Q
    ||||||||||||||||||||||||||||||||    
24089011 acatatatgcatgtggtaccaaatcacctcaa 24088980  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 521 - 552
Target Start/End: Complemental strand, 36892400 - 36892369
Alignment:
521 acatatatgcatgtggtaccaaatcacctcaa 552  Q
    ||||||||||||||||||||||||||||||||    
36892400 acatatatgcatgtggtaccaaatcacctcaa 36892369  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 6)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 511 - 564
Target Start/End: Original strand, 21930411 - 21930464
Alignment:
511 tatacacaagacatatatgcatgtggtaccaaatcacctcaaagatcgtcacct 564  Q
    ||||||| | |||||||||||||||||||||||||||||||||| |||||||||    
21930411 tatacacgacacatatatgcatgtggtaccaaatcacctcaaaggtcgtcacct 21930464  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 521 - 552
Target Start/End: Original strand, 18422263 - 18422294
Alignment:
521 acatatatgcatgtggtaccaaatcacctcaa 552  Q
    ||||||||||||||||||||||||||||||||    
18422263 acatatatgcatgtggtaccaaatcacctcaa 18422294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 521 - 552
Target Start/End: Original strand, 19852799 - 19852830
Alignment:
521 acatatatgcatgtggtaccaaatcacctcaa 552  Q
    ||||||||||||||||||||||||||||||||    
19852799 acatatatgcatgtggtaccaaatcacctcaa 19852830  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 521 - 552
Target Start/End: Original strand, 23220226 - 23220257
Alignment:
521 acatatatgcatgtggtaccaaatcacctcaa 552  Q
    ||||||||||||||||||||||||||||||||    
23220226 acatatatgcatgtggtaccaaatcacctcaa 23220257  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 521 - 552
Target Start/End: Original strand, 34965474 - 34965505
Alignment:
521 acatatatgcatgtggtaccaaatcacctcaa 552  Q
    ||||||||||||||||||||||||||||||||    
34965474 acatatatgcatgtggtaccaaatcacctcaa 34965505  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 521 - 551
Target Start/End: Complemental strand, 35017343 - 35017313
Alignment:
521 acatatatgcatgtggtaccaaatcacctca 551  Q
    |||||||||||||||||||||||||||||||    
35017343 acatatatgcatgtggtaccaaatcacctca 35017313  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 11)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 511 - 564
Target Start/End: Original strand, 15989497 - 15989550
Alignment:
511 tatacacaagacatatatgcatgtggtaccaaatcacctcaaagatcgtcacct 564  Q
    ||||||| | |||||||||||||||||||||||||||||||||| |||||||||    
15989497 tatacacgatacatatatgcatgtggtaccaaatcacctcaaaggtcgtcacct 15989550  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 521 - 563
Target Start/End: Complemental strand, 16183705 - 16183664
Alignment:
521 acatatatgcatgtggtaccaaatcacctcaaagatcgtcacc 563  Q
    |||||||||||||||||||||||||||||||||| ||||||||    
16183705 acatatatgcatgtggtaccaaatcacctcaaag-tcgtcacc 16183664  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 522 - 564
Target Start/End: Complemental strand, 38377455 - 38377413
Alignment:
522 catatatgcatgtggtaccaaatcacctcaaagatcgtcacct 564  Q
    |||||||||||||||||||||||||||| |||| |||||||||    
38377455 catatatgcatgtggtaccaaatcaccttaaaggtcgtcacct 38377413  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 521 - 563
Target Start/End: Original strand, 41660139 - 41660180
Alignment:
521 acatatatgcatgtggtaccaaatcacctcaaagatcgtcacc 563  Q
    |||||||||||||||||||||||||||||| ||||||||||||    
41660139 acatatatgcatgtggtaccaaatcacctc-aagatcgtcacc 41660180  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 521 - 552
Target Start/End: Complemental strand, 5229717 - 5229686
Alignment:
521 acatatatgcatgtggtaccaaatcacctcaa 552  Q
    ||||||||||||||||||||||||||||||||    
5229717 acatatatgcatgtggtaccaaatcacctcaa 5229686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 521 - 552
Target Start/End: Complemental strand, 6148497 - 6148466
Alignment:
521 acatatatgcatgtggtaccaaatcacctcaa 552  Q
    ||||||||||||||||||||||||||||||||    
6148497 acatatatgcatgtggtaccaaatcacctcaa 6148466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 521 - 552
Target Start/End: Complemental strand, 9592390 - 9592359
Alignment:
521 acatatatgcatgtggtaccaaatcacctcaa 552  Q
    ||||||||||||||||||||||||||||||||    
9592390 acatatatgcatgtggtaccaaatcacctcaa 9592359  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 521 - 564
Target Start/End: Complemental strand, 11883963 - 11883921
Alignment:
521 acatatatgcatgtggtaccaaatcacctcaaagatcgtcacct 564  Q
    ||||||||||||||||||||||||||| |||||| |||||||||    
11883963 acatatatgcatgtggtaccaaatcacttcaaag-tcgtcacct 11883921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 521 - 552
Target Start/End: Complemental strand, 14523046 - 14523015
Alignment:
521 acatatatgcatgtggtaccaaatcacctcaa 552  Q
    ||||||||||||||||||||||||||||||||    
14523046 acatatatgcatgtggtaccaaatcacctcaa 14523015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 521 - 552
Target Start/End: Complemental strand, 33371003 - 33370972
Alignment:
521 acatatatgcatgtggtaccaaatcacctcaa 552  Q
    ||||||||||||||||||||||||||||||||    
33371003 acatatatgcatgtggtaccaaatcacctcaa 33370972  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 521 - 551
Target Start/End: Original strand, 11813363 - 11813393
Alignment:
521 acatatatgcatgtggtaccaaatcacctca 551  Q
    |||||||||||||||||||||||||||||||    
11813363 acatatatgcatgtggtaccaaatcacctca 11813393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 10)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 511 - 564
Target Start/End: Complemental strand, 77683 - 77630
Alignment:
511 tatacacaagacatatatgcatgtggtaccaaatcacctcaaagatcgtcacct 564  Q
    ||||||| | |||||||||||||||||||||||||||||||||| |||||||||    
77683 tatacacgacacatatatgcatgtggtaccaaatcacctcaaaggtcgtcacct 77630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 521 - 563
Target Start/End: Complemental strand, 2422773 - 2422732
Alignment:
521 acatatatgcatgtggtaccaaatcacctcaaagatcgtcacc 563  Q
    |||||||||||||||||||||||||||||||||| ||||||||    
2422773 acatatatgcatgtggtaccaaatcacctcaaag-tcgtcacc 2422732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 521 - 552
Target Start/End: Complemental strand, 5472024 - 5471993
Alignment:
521 acatatatgcatgtggtaccaaatcacctcaa 552  Q
    ||||||||||||||||||||||||||||||||    
5472024 acatatatgcatgtggtaccaaatcacctcaa 5471993  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 521 - 552
Target Start/End: Complemental strand, 5769854 - 5769823
Alignment:
521 acatatatgcatgtggtaccaaatcacctcaa 552  Q
    ||||||||||||||||||||||||||||||||    
5769854 acatatatgcatgtggtaccaaatcacctcaa 5769823  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 521 - 552
Target Start/End: Original strand, 21193693 - 21193724
Alignment:
521 acatatatgcatgtggtaccaaatcacctcaa 552  Q
    ||||||||||||||||||||||||||||||||    
21193693 acatatatgcatgtggtaccaaatcacctcaa 21193724  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 521 - 552
Target Start/End: Complemental strand, 22145032 - 22145001
Alignment:
521 acatatatgcatgtggtaccaaatcacctcaa 552  Q
    ||||||||||||||||||||||||||||||||    
22145032 acatatatgcatgtggtaccaaatcacctcaa 22145001  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 521 - 552
Target Start/End: Complemental strand, 22407934 - 22407903
Alignment:
521 acatatatgcatgtggtaccaaatcacctcaa 552  Q
    ||||||||||||||||||||||||||||||||    
22407934 acatatatgcatgtggtaccaaatcacctcaa 22407903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 521 - 552
Target Start/End: Complemental strand, 37235601 - 37235570
Alignment:
521 acatatatgcatgtggtaccaaatcacctcaa 552  Q
    ||||||||||||||||||||||||||||||||    
37235601 acatatatgcatgtggtaccaaatcacctcaa 37235570  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 521 - 552
Target Start/End: Complemental strand, 41213307 - 41213276
Alignment:
521 acatatatgcatgtggtaccaaatcacctcaa 552  Q
    ||||||||||||||||||||||||||||||||    
41213307 acatatatgcatgtggtaccaaatcacctcaa 41213276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 521 - 552
Target Start/End: Original strand, 49966111 - 49966142
Alignment:
521 acatatatgcatgtggtaccaaatcacctcaa 552  Q
    ||||||||||||||||||||||||||||||||    
49966111 acatatatgcatgtggtaccaaatcacctcaa 49966142  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0601 (Bit Score: 38; Significance: 0.000000000003; HSPs: 1)
Name: scaffold0601
Description:

Target: scaffold0601; HSP #1
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 511 - 564
Target Start/End: Complemental strand, 2629 - 2576
Alignment:
511 tatacacaagacatatatgcatgtggtaccaaatcacctcaaagatcgtcacct 564  Q
    |||| |||| |||||||||| ||||||||||||||||||||||| |||||||||    
2629 tatagacaacacatatatgcgtgtggtaccaaatcacctcaaaggtcgtcacct 2576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 38; Significance: 0.000000000003; HSPs: 7)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 511 - 564
Target Start/End: Complemental strand, 21676684 - 21676631
Alignment:
511 tatacacaagacatatatgcatgtggtaccaaatcacctcaaagatcgtcacct 564  Q
    ||||||| | ||||||||||||||||||||||||| |||||||| |||||||||    
21676684 tatacacgacacatatatgcatgtggtaccaaatcgcctcaaaggtcgtcacct 21676631  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 521 - 552
Target Start/End: Original strand, 142096 - 142127
Alignment:
521 acatatatgcatgtggtaccaaatcacctcaa 552  Q
    ||||||||||||||||||||||||||||||||    
142096 acatatatgcatgtggtaccaaatcacctcaa 142127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 521 - 552
Target Start/End: Complemental strand, 9058272 - 9058241
Alignment:
521 acatatatgcatgtggtaccaaatcacctcaa 552  Q
    ||||||||||||||||||||||||||||||||    
9058272 acatatatgcatgtggtaccaaatcacctcaa 9058241  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 521 - 552
Target Start/End: Complemental strand, 15824144 - 15824113
Alignment:
521 acatatatgcatgtggtaccaaatcacctcaa 552  Q
    ||||||||||||||||||||||||||||||||    
15824144 acatatatgcatgtggtaccaaatcacctcaa 15824113  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 521 - 552
Target Start/End: Complemental strand, 20587250 - 20587219
Alignment:
521 acatatatgcatgtggtaccaaatcacctcaa 552  Q
    ||||||||||||||||||||||||||||||||    
20587250 acatatatgcatgtggtaccaaatcacctcaa 20587219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 521 - 552
Target Start/End: Original strand, 44863671 - 44863702
Alignment:
521 acatatatgcatgtggtaccaaatcacctcaa 552  Q
    ||||||||||||||||||||||||||||||||    
44863671 acatatatgcatgtggtaccaaatcacctcaa 44863702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 523 - 552
Target Start/End: Complemental strand, 8565216 - 8565187
Alignment:
523 atatatgcatgtggtaccaaatcacctcaa 552  Q
    ||||||||||||||||||||||||||||||    
8565216 atatatgcatgtggtaccaaatcacctcaa 8565187  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 37; Significance: 0.00000000001; HSPs: 7)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 511 - 563
Target Start/End: Complemental strand, 54365225 - 54365173
Alignment:
511 tatacacaagacatatatgcatgtggtaccaaatcacctcaaagatcgtcacc 563  Q
    ||||||| | || ||||||||||||||||||||||||||||||| ||||||||    
54365225 tatacacgatacgtatatgcatgtggtaccaaatcacctcaaaggtcgtcacc 54365173  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 521 - 563
Target Start/End: Complemental strand, 5372338 - 5372297
Alignment:
521 acatatatgcatgtggtaccaaatcacctcaaagatcgtcacc 563  Q
    |||||||||||||||||||||||||||||| ||||||||||||    
5372338 acatatatgcatgtggtaccaaatcacctc-aagatcgtcacc 5372297  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 521 - 552
Target Start/End: Complemental strand, 10239077 - 10239046
Alignment:
521 acatatatgcatgtggtaccaaatcacctcaa 552  Q
    ||||||||||||||||||||||||||||||||    
10239077 acatatatgcatgtggtaccaaatcacctcaa 10239046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 521 - 552
Target Start/End: Complemental strand, 41257992 - 41257961
Alignment:
521 acatatatgcatgtggtaccaaatcacctcaa 552  Q
    ||||||||||||||||||||||||||||||||    
41257992 acatatatgcatgtggtaccaaatcacctcaa 41257961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 521 - 551
Target Start/End: Complemental strand, 53909471 - 53909441
Alignment:
521 acatatatgcatgtggtaccaaatcacctca 551  Q
    |||||||||||||||||||||||||||||||    
53909471 acatatatgcatgtggtaccaaatcacctca 53909441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 511 - 552
Target Start/End: Complemental strand, 17377090 - 17377049
Alignment:
511 tatacacaagacatatatgcatgtggtaccaaatcacctcaa 552  Q
    ||||||| | ||||||||| ||||||||||||||||||||||    
17377090 tatacacgacacatatatgaatgtggtaccaaatcacctcaa 17377049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 521 - 549
Target Start/End: Original strand, 33738691 - 33738719
Alignment:
521 acatatatgcatgtggtaccaaatcacct 549  Q
    |||||||||||||||||||||||||||||    
33738691 acatatatgcatgtggtaccaaatcacct 33738719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 35; Significance: 0.0000000002; HSPs: 13)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 521 - 563
Target Start/End: Complemental strand, 23153448 - 23153407
Alignment:
521 acatatatgcatgtggtaccaaatcacctcaaagatcgtcacc 563  Q
    |||||||||||||||||||||||||||||| ||||||||||||    
23153448 acatatatgcatgtggtaccaaatcacctc-aagatcgtcacc 23153407  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 521 - 554
Target Start/End: Original strand, 22312194 - 22312227
Alignment:
521 acatatatgcatgtggtaccaaatcacctcaaag 554  Q
    ||||||||||||||||||||||||||||||||||    
22312194 acatatatgcatgtggtaccaaatcacctcaaag 22312227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 521 - 552
Target Start/End: Original strand, 16416770 - 16416801
Alignment:
521 acatatatgcatgtggtaccaaatcacctcaa 552  Q
    ||||||||||||||||||||||||||||||||    
16416770 acatatatgcatgtggtaccaaatcacctcaa 16416801  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 521 - 552
Target Start/End: Complemental strand, 19994842 - 19994811
Alignment:
521 acatatatgcatgtggtaccaaatcacctcaa 552  Q
    ||||||||||||||||||||||||||||||||    
19994842 acatatatgcatgtggtaccaaatcacctcaa 19994811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 521 - 552
Target Start/End: Complemental strand, 22498942 - 22498911
Alignment:
521 acatatatgcatgtggtaccaaatcacctcaa 552  Q
    ||||||||||||||||||||||||||||||||    
22498942 acatatatgcatgtggtaccaaatcacctcaa 22498911  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 521 - 552
Target Start/End: Complemental strand, 24719117 - 24719086
Alignment:
521 acatatatgcatgtggtaccaaatcacctcaa 552  Q
    ||||||||||||||||||||||||||||||||    
24719117 acatatatgcatgtggtaccaaatcacctcaa 24719086  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 521 - 552
Target Start/End: Original strand, 25120972 - 25121003
Alignment:
521 acatatatgcatgtggtaccaaatcacctcaa 552  Q
    ||||||||||||||||||||||||||||||||    
25120972 acatatatgcatgtggtaccaaatcacctcaa 25121003  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 521 - 552
Target Start/End: Original strand, 33170789 - 33170820
Alignment:
521 acatatatgcatgtggtaccaaatcacctcaa 552  Q
    ||||||||||||||||||||||||||||||||    
33170789 acatatatgcatgtggtaccaaatcacctcaa 33170820  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 521 - 552
Target Start/End: Original strand, 41244161 - 41244192
Alignment:
521 acatatatgcatgtggtaccaaatcacctcaa 552  Q
    ||||||||||||||||||||||||||||||||    
41244161 acatatatgcatgtggtaccaaatcacctcaa 41244192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 522 - 552
Target Start/End: Original strand, 25294527 - 25294557
Alignment:
522 catatatgcatgtggtaccaaatcacctcaa 552  Q
    |||||||||||||||||||||||||||||||    
25294527 catatatgcatgtggtaccaaatcacctcaa 25294557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 522 - 552
Target Start/End: Original strand, 25756516 - 25756546
Alignment:
522 catatatgcatgtggtaccaaatcacctcaa 552  Q
    |||||||||||||||||||||||||||||||    
25756516 catatatgcatgtggtaccaaatcacctcaa 25756546  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 511 - 552
Target Start/End: Original strand, 24238059 - 24238100
Alignment:
511 tatacacaagacatatatgcatgtggtaccaaatcacctcaa 552  Q
    ||||||| | |||||||||||||||||||||||||| |||||    
24238059 tatacacgacacatatatgcatgtggtaccaaatcagctcaa 24238100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 523 - 552
Target Start/End: Complemental strand, 33612698 - 33612669
Alignment:
523 atatatgcatgtggtaccaaatcacctcaa 552  Q
    ||||||||||||||||||||||||||||||    
33612698 atatatgcatgtggtaccaaatcacctcaa 33612669  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0786 (Bit Score: 32; Significance: 0.00000001; HSPs: 2)
Name: scaffold0786
Description:

Target: scaffold0786; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 521 - 552
Target Start/End: Original strand, 215 - 246
Alignment:
521 acatatatgcatgtggtaccaaatcacctcaa 552  Q
    ||||||||||||||||||||||||||||||||    
215 acatatatgcatgtggtaccaaatcacctcaa 246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0786; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 521 - 552
Target Start/End: Original strand, 5270 - 5301
Alignment:
521 acatatatgcatgtggtaccaaatcacctcaa 552  Q
    ||||||||||||||||||||||||||||||||    
5270 acatatatgcatgtggtaccaaatcacctcaa 5301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0673 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0673
Description:

Target: scaffold0673; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 521 - 552
Target Start/End: Complemental strand, 3747 - 3716
Alignment:
521 acatatatgcatgtggtaccaaatcacctcaa 552  Q
    ||||||||||||||||||||||||||||||||    
3747 acatatatgcatgtggtaccaaatcacctcaa 3716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0396 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0396
Description:

Target: scaffold0396; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 521 - 552
Target Start/End: Complemental strand, 13830 - 13799
Alignment:
521 acatatatgcatgtggtaccaaatcacctcaa 552  Q
    ||||||||||||||||||||||||||||||||    
13830 acatatatgcatgtggtaccaaatcacctcaa 13799  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0390 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0390
Description:

Target: scaffold0390; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 521 - 552
Target Start/End: Original strand, 3803 - 3834
Alignment:
521 acatatatgcatgtggtaccaaatcacctcaa 552  Q
    ||||||||||||||||||||||||||||||||    
3803 acatatatgcatgtggtaccaaatcacctcaa 3834  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0292 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0292
Description:

Target: scaffold0292; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 521 - 552
Target Start/End: Original strand, 18111 - 18142
Alignment:
521 acatatatgcatgtggtaccaaatcacctcaa 552  Q
    ||||||||||||||||||||||||||||||||    
18111 acatatatgcatgtggtaccaaatcacctcaa 18142  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0243 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0243
Description:

Target: scaffold0243; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 521 - 552
Target Start/End: Complemental strand, 3935 - 3904
Alignment:
521 acatatatgcatgtggtaccaaatcacctcaa 552  Q
    ||||||||||||||||||||||||||||||||    
3935 acatatatgcatgtggtaccaaatcacctcaa 3904  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0190 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0190
Description:

Target: scaffold0190; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 521 - 552
Target Start/End: Original strand, 8604 - 8635
Alignment:
521 acatatatgcatgtggtaccaaatcacctcaa 552  Q
    ||||||||||||||||||||||||||||||||    
8604 acatatatgcatgtggtaccaaatcacctcaa 8635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0037 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0037
Description:

Target: scaffold0037; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 521 - 552
Target Start/End: Complemental strand, 26456 - 26425
Alignment:
521 acatatatgcatgtggtaccaaatcacctcaa 552  Q
    ||||||||||||||||||||||||||||||||    
26456 acatatatgcatgtggtaccaaatcacctcaa 26425  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0022 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0022
Description:

Target: scaffold0022; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 521 - 552
Target Start/End: Original strand, 130413 - 130444
Alignment:
521 acatatatgcatgtggtaccaaatcacctcaa 552  Q
    ||||||||||||||||||||||||||||||||    
130413 acatatatgcatgtggtaccaaatcacctcaa 130444  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0021 (Bit Score: 32; Significance: 0.00000001; HSPs: 2)
Name: scaffold0021
Description:

Target: scaffold0021; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 521 - 552
Target Start/End: Original strand, 76813 - 76844
Alignment:
521 acatatatgcatgtggtaccaaatcacctcaa 552  Q
    ||||||||||||||||||||||||||||||||    
76813 acatatatgcatgtggtaccaaatcacctcaa 76844  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0021; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 521 - 552
Target Start/End: Complemental strand, 138446 - 138415
Alignment:
521 acatatatgcatgtggtaccaaatcacctcaa 552  Q
    ||||||||||||||||||||||||||||||||    
138446 acatatatgcatgtggtaccaaatcacctcaa 138415  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0016 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0016
Description:

Target: scaffold0016; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 521 - 552
Target Start/End: Original strand, 163861 - 163892
Alignment:
521 acatatatgcatgtggtaccaaatcacctcaa 552  Q
    ||||||||||||||||||||||||||||||||    
163861 acatatatgcatgtggtaccaaatcacctcaa 163892  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0011 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0011
Description:

Target: scaffold0011; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 521 - 552
Target Start/End: Complemental strand, 256600 - 256569
Alignment:
521 acatatatgcatgtggtaccaaatcacctcaa 552  Q
    ||||||||||||||||||||||||||||||||    
256600 acatatatgcatgtggtaccaaatcacctcaa 256569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0004 (Bit Score: 32; Significance: 0.00000001; HSPs: 2)
Name: scaffold0004
Description:

Target: scaffold0004; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 521 - 552
Target Start/End: Original strand, 84946 - 84977
Alignment:
521 acatatatgcatgtggtaccaaatcacctcaa 552  Q
    ||||||||||||||||||||||||||||||||    
84946 acatatatgcatgtggtaccaaatcacctcaa 84977  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0004; HSP #2
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 521 - 563
Target Start/End: Original strand, 26084 - 26125
Alignment:
521 acatatatgcatgtggtaccaaatcacctcaaagatcgtcacc 563  Q
    ||||||||||||||||||||||||||||| |||| ||||||||    
26084 acatatatgcatgtggtaccaaatcacct-aaaggtcgtcacc 26125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 32; Significance: 0.00000001; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 521 - 552
Target Start/End: Complemental strand, 5452472 - 5452441
Alignment:
521 acatatatgcatgtggtaccaaatcacctcaa 552  Q
    ||||||||||||||||||||||||||||||||    
5452472 acatatatgcatgtggtaccaaatcacctcaa 5452441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 521 - 552
Target Start/End: Complemental strand, 20455737 - 20455706
Alignment:
521 acatatatgcatgtggtaccaaatcacctcaa 552  Q
    ||||||||||||||||||||||||||||||||    
20455737 acatatatgcatgtggtaccaaatcacctcaa 20455706  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 521 - 552
Target Start/End: Original strand, 21615540 - 21615571
Alignment:
521 acatatatgcatgtggtaccaaatcacctcaa 552  Q
    ||||||||||||||||||||||||||||||||    
21615540 acatatatgcatgtggtaccaaatcacctcaa 21615571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0269 (Bit Score: 31; Significance: 0.00000005; HSPs: 1)
Name: scaffold0269
Description:

Target: scaffold0269; HSP #1
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 521 - 551
Target Start/End: Original strand, 3478 - 3508
Alignment:
521 acatatatgcatgtggtaccaaatcacctca 551  Q
    |||||||||||||||||||||||||||||||    
3478 acatatatgcatgtggtaccaaatcacctca 3508  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0171 (Bit Score: 31; Significance: 0.00000005; HSPs: 1)
Name: scaffold0171
Description:

Target: scaffold0171; HSP #1
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 521 - 551
Target Start/End: Original strand, 31264 - 31294
Alignment:
521 acatatatgcatgtggtaccaaatcacctca 551  Q
    |||||||||||||||||||||||||||||||    
31264 acatatatgcatgtggtaccaaatcacctca 31294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0116 (Bit Score: 31; Significance: 0.00000005; HSPs: 1)
Name: scaffold0116
Description:

Target: scaffold0116; HSP #1
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 521 - 551
Target Start/End: Original strand, 28287 - 28317
Alignment:
521 acatatatgcatgtggtaccaaatcacctca 551  Q
    |||||||||||||||||||||||||||||||    
28287 acatatatgcatgtggtaccaaatcacctca 28317  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0049 (Bit Score: 31; Significance: 0.00000005; HSPs: 1)
Name: scaffold0049
Description:

Target: scaffold0049; HSP #1
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 521 - 551
Target Start/End: Original strand, 31050 - 31080
Alignment:
521 acatatatgcatgtggtaccaaatcacctca 551  Q
    |||||||||||||||||||||||||||||||    
31050 acatatatgcatgtggtaccaaatcacctca 31080  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0039 (Bit Score: 31; Significance: 0.00000005; HSPs: 1)
Name: scaffold0039
Description:

Target: scaffold0039; HSP #1
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 521 - 551
Target Start/End: Complemental strand, 20946 - 20916
Alignment:
521 acatatatgcatgtggtaccaaatcacctca 551  Q
    |||||||||||||||||||||||||||||||    
20946 acatatatgcatgtggtaccaaatcacctca 20916  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0193 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: scaffold0193
Description:

Target: scaffold0193; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 521 - 550
Target Start/End: Original strand, 3283 - 3312
Alignment:
521 acatatatgcatgtggtaccaaatcacctc 550  Q
    ||||||||||||||||||||||||||||||    
3283 acatatatgcatgtggtaccaaatcacctc 3312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 137345 times since January 2019
Visitors: 1446