View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1613-INSERTION-7 (Length: 632)

Name: NF1613-INSERTION-7
Description: NF1613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1613-INSERTION-7
NF1613-INSERTION-7
[»] chr4 (1 HSPs)
chr4 (7-632)||(45016264-45016888)


Alignment Details
Target: chr4 (Bit Score: 500; Significance: 0; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 500; E-Value: 0
Query Start/End: Original strand, 7 - 632
Target Start/End: Complemental strand, 45016888 - 45016264
Alignment:
7 atgcaagatgtccaagttcacctaattactctggaaaatacccctaaggtacaatttgatactctataagactattcattcctaagttgcttaagacatg 106  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45016888 atgcaagatgtccaagttcacctaattactctggaaaatacccctaaggtacaatttgatactctataagactattcattcctaagttgcttaagacatg 45016789  T
107 tgctattgcannnnnnngttttaaatttaataagcttatatttgtgtacaggttattactgagaaaaacatgcacttggaagagccaaagccaagaatta 206  Q
    ||||||||||       ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
45016788 tgctattgcatttttttgttttaaatttaacaagcttatatttgtgtacaggttattactgagaaaaacatgcatttggaagagccaaagccaagaatta 45016689  T
207 atgagaggatggatttagaactcaatgattatgcaccatctggggcaaatggtcgtcacactccaagagcaccgtaatggtgtgtaagctgattaaatgt 306  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45016688 atgagaggatggatttagaactcaatgattatgcaccatctggggcaaatggtcgtcacactccaagagcaccgtaatggtgtgtaagctgattaaatgt 45016589  T
307 tagtagttcctctagctaggtgccnnnnnnnnnnnnngcatgcatcctctatgtaaaacaatattaattaagttaatatatgagttttattgtagaggca 406  Q
    ||||||||||||||||||||||||             |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45016588 tagtagttcctctagctaggtgcc---tatattatatgcatgcatcctctatgtaaaacaatattaattaagttaatatatgagttttattgtagaggca 45016492  T
407 tttatatatgatgaaagaaaggactaaatattaagagtaaatcaaatccccattgtttatgatgtatgggatcttagaaactcatgtacgttaa-aaaca 505  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||  ||||    
45016491 tttatatatgatgaaagaaaggactaaatatt-agagtaaatcaaatccccattgtttatgatgtatgggatcgtaggaactcatgtacgttaattaaca 45016393  T
506 tcttcttatgtatccatgtactagaatttcaattatagttatataatttattga-cctattatgttctgtcgcag-aatgatatttgatcagttacacta 603  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||| ||| ||||||||||||||||||||||||    
45016392 tcttcttatgtatccatgtagtagaatttcaattatagttatataatttattgaccctattatgttctgtcacagaaatgatatttgatcagttacacta 45016293  T
604 tcagttctaagaaacagccattgattttg 632  Q
    ||||||||||| |||||||||||||||||    
45016292 tcagttctaagtaacagccattgattttg 45016264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 136854 times since January 2019
Visitors: 1443