View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1613_high_1 (Length: 479)

Name: NF1613_high_1
Description: NF1613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1613_high_1
NF1613_high_1
[»] chr3 (1 HSPs)
chr3 (12-465)||(52912987-52913440)
[»] chr5 (1 HSPs)
chr5 (133-197)||(16846156-16846220)


Alignment Details
Target: chr3 (Bit Score: 446; Significance: 0; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 446; E-Value: 0
Query Start/End: Original strand, 12 - 465
Target Start/End: Complemental strand, 52913440 - 52912987
Alignment:
12 attcttttaaagctcaccgttaatctaaacatgtacttaccatcttctggctgagaggctggcgttgaattcttgccaatcacaatttggacatggattg 111  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52913440 attcttttaaagctcaccgttaatctaaacatgcacttaccatcttctggctgagaggctggcgttgaattcttgccaatcacaatttggacatggattg 52913341  T
112 aaggttctaacgctacggtctccatcgttgaaaccaccggtttggataagagttccgttgggattgacggaaccggaggaacaccagatgttggtttgga 211  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52913340 aaggttctaacgctacggtctccatcgttgaaaccaccggtttggataagagttccgttgggattgacggaaccggaggaacaccagatgttggtttgga 52913241  T
212 tgaagagtggtcggaatgtattagaaaagacgtcatattcaagggagtgagcagtgcaatcatttttaacagcttgctcttgtgggttaacacggcatct 311  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
52913240 tgaagagtggtcggaatgtattagaaaagacgtcatattcaagggagtgagcagtgcaatcatttttcacagcttgctcttgtgggttaacacggcatct 52913141  T
312 accgttgggtaaagataagtttgagaagccaaaatctgtacggtcaaaaatgatgacacggtcgttgtgtagtaattgcatatgcatggctacaatgcca 411  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52913140 accgttgggtaaagataagtttgagaagccaaaatctgtacggtcaaaaatgatgacacggtcgttgtgtagtaattgcatatgcatggctacaatgcca 52913041  T
412 atgttgttttgtaagagctgccattgtccaccagcggctatagctggagatgga 465  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52913040 atgttgttttgtaagagctgccattgtccaccagcggctatagctggagatgga 52912987  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 29; Significance: 0.0000007; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 133 - 197
Target Start/End: Complemental strand, 16846220 - 16846156
Alignment:
133 ccatcgttgaaaccaccggtttggataagagttccgttgggattgacggaaccggaggaacacca 197  Q
    ||||||||||| |||||||||||||| || |||||| ||||   ||| | |||||||||||||||    
16846220 ccatcgttgaagccaccggtttggattagggttccggtgggggagactgcaccggaggaacacca 16846156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 136780 times since January 2019
Visitors: 1443