View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1613_high_10 (Length: 263)

Name: NF1613_high_10
Description: NF1613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF1613_high_10
[»] chr3 (2 HSPs)
chr3 (1-210)||(26017781-26017990)
chr3 (4-210)||(26003035-26003241)
[»] chr5 (1 HSPs)
chr5 (26-202)||(30374295-30374471)

Alignment Details
Target: chr3 (Bit Score: 178; Significance: 4e-96; HSPs: 2)
Name: chr3

Target: chr3; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 210
Target Start/End: Complemental strand, 26017990 - 26017781
1 attgcaattaattgatgaagtcctataccttttcccataatccatctgaagctaagattaacaagtcatggtgaggttcaattctgagtactttggtctc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||    
26017990 attgcaattaattgatgaagtcctataccttttcccataatccatctgaagctaagattaaaaagtcatgatgaggttcaattctgagtactttggtctc 26017891  T
101 aggctctgctatcacccattgtttcatgtgtccatcaccaatgctccttgaaacagcaagagatccttggattctccaaacaccgcggcacatatcaaca 200  Q
    ||| |||||||||||  ||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||    
26017890 aggttctgctatcacatattgtttcatgtgtctatctccaatgctccttgaaacagcaagagatccttggattctccaaacaccgcggcacatatctaca 26017791  T
201 tatcctccct 210  Q
26017790 tatcctccct 26017781  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 4 - 210
Target Start/End: Complemental strand, 26003241 - 26003035
4 gcaattaattgatgaagtcctataccttttcccataatccatctgaagctaagattaacaagtcatggtgaggttcaattctgagtactttggtctcagg 103  Q
    ||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
26003241 gcaattaattggtcaagtcctataccttttcccataatccatctgaagctaagattaacaagtcatgatgaggttcaattctgagtactttggtctcagg 26003142  T
104 ctctgctatcacccattgtttcatgtgtccatcaccaatgctccttgaaacagcaagagatccttggattctccaaacaccgcggcacatatcaacatat 203  Q
     |||||||||||  ||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
26003141 ttctgctatcacatattgtttcatgtgtctatctccaatgctccttgaaacagcaagagatccttggattctccaaacaccgcggcacatatcgacatat 26003042  T
204 cctccct 210  Q
26003041 cctccct 26003035  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: chr5

Target: chr5; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 26 - 202
Target Start/End: Complemental strand, 30374471 - 30374295
26 taccttttcccataatccatctgaagctaagattaacaagtcatggtgaggttcaattctgagtactttggtctcaggctctgctatcacccattgtttc 125  Q
    |||||| ||||||||||||||||||||||| |||||||||||||| | |||||||||||| |  ||||| ||||| ||||| ||| ||||||||||||||    
30374471 taccttatcccataatccatctgaagctaatattaacaagtcatgttcaggttcaattctaataactttagtctcgggctccgctgtcacccattgtttc 30374372  T
126 atgtgtccatcaccaatgctccttgaaacagcaagagatccttggattctccaaacaccgcggcacatatcaacata 202  Q
    | |||||  || ||||| |  ||||| ||||||||||||||||| || |||||||||||||| || | |||||||||    
30374371 aagtgtcggtctccaattcctcttgatacagcaagagatccttgaatcctccaaacaccgcgacataaatcaacata 30374295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 137212 times since January 2019
Visitors: 1446