View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1613_high_11 (Length: 246)

Name: NF1613_high_11
Description: NF1613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF1613_high_11
[»] chr4 (1 HSPs)
chr4 (4-232)||(40063637-40063866)

Alignment Details
Target: chr4 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr4

Target: chr4; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 4 - 232
Target Start/End: Complemental strand, 40063866 - 40063637
4 aataattgttttaagagaacaaaaatcataatccaatacatgtccttattattaa-taaataataatgtcaactataaaattcttttcattttatgtata 102  Q
    ||||||| |||||||| ||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||  ||||||    
40063866 aataatttttttaagataacaaaaatcataatccaatagatgtccttattattaaataaataataatgtcaactataaaattcttttcatttattgtata 40063767  T
103 tttggagtgatattttgcctctattttgacattcatataactaatgacacatcatcaaagcaaagttagtaccaattccaaccccagcctgcagatgagt 202  Q
    ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40063766 ttttgagtgatattttgcctctattttgacattcatataactaatgacacatcatcaaagcaaagttagtaccaattccaaccccagcctgcagatgagt 40063667  T
203 gagttttgccaaactagcacgcctcaatat 232  Q
40063666 gagttttgccaaactagcacgcctcaatat 40063637  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 137340 times since January 2019
Visitors: 1446