View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1613_high_12 (Length: 245)

Name: NF1613_high_12
Description: NF1613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1613_high_12
NF1613_high_12
[»] chr6 (1 HSPs)
chr6 (4-239)||(14408502-14408737)
[»] scaffold1515 (1 HSPs)
scaffold1515 (38-239)||(1-202)
[»] scaffold1889 (1 HSPs)
scaffold1889 (4-172)||(845-1013)


Alignment Details
Target: chr6 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 4 - 239
Target Start/End: Original strand, 14408502 - 14408737
Alignment:
4 cacgagcgttggagtagttaacatagccatatccaagagatgactgcgtcatctgatctctgcaaaccctaacagaaatcacaggggcaatctggctgaa 103  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14408502 cacgagcgttggagtagttaacatagccataaccaagagatgactgcgtcatctgatctctgcaaaccctaacagaaatcacaggggcaatctggctgaa 14408601  T
104 cagatcatacagctgcgcatcatttacgttcccttgaagatcaccgacgtacaaagaagaattctcaaatcttccagcactggtcaaagctgctggaaca 203  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14408602 cagatcatacagctgcgcatcatttacgttcccttgaagatcaccgacgtacaaagaagaattctcaaatcttccagcactggtcaaagctgctggaaca 14408701  T
204 acgatcgttggagatgaaattattgctgcctttgct 239  Q
    |||||| |||| ||||||| |||||||||| |||||    
14408702 acgatctttggtgatgaaactattgctgccattgct 14408737  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1515 (Bit Score: 86; Significance: 3e-41; HSPs: 1)
Name: scaffold1515
Description:

Target: scaffold1515; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 38 - 239
Target Start/End: Original strand, 1 - 202
Alignment:
38 aagagatgactgcgtcatctgatctctgcaaaccctaacagaaatcacaggggcaatctggctgaacagatcatacagctgcgcatcatttacgttccct 137  Q
    |||||||||||||||||||||||| | |||||||||| |||||| ||| || |||||||| |||||||||||||| |||||  | ||||| ||||||| |    
1 aagagatgactgcgtcatctgatcccggcaaaccctagcagaaagcactggtgcaatctgactgaacagatcataaagctggccctcattgacgttcctt 100  T
138 tgaagatcaccgacgtacaaagaagaattctcaaatcttccagcactggtcaaagctgctggaacaacgatcgttggagatgaaattattgctgcctttg 237  Q
    |  |||||||| ||||| || ||||   ||||||||||||||| || ||||||||||||||||||||||||| |||| |||||||  | ||||||| |||    
101 tcgagatcaccaacgtataaggaagcggtctcaaatcttccagtaccggtcaaagctgctggaacaacgatctttggtgatgaaaccactgctgccattg 200  T
238 ct 239  Q
    ||    
201 ct 202  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1889 (Bit Score: 57; Significance: 6e-24; HSPs: 1)
Name: scaffold1889
Description:

Target: scaffold1889; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 4 - 172
Target Start/End: Complemental strand, 1013 - 845
Alignment:
4 cacgagcgttggagtagttaacatagccatatccaagagatgactgcgtcatctgatctctgcaaaccctaacagaaatcacaggggcaatctggctgaa 103  Q
    |||||||||||||| |||| ||||||||||| |||||||||||||||||||||||||| || |||||||| || ||||| ||  || |||||||   ||     
1013 cacgagcgttggagaagttgacatagccataaccaagagatgactgcgtcatctgatccctacaaaccctgacggaaataacgtggccaatctgatagag 914  T
104 cagatcatacagctgcgcatcatttacgttcccttgaagatcaccgacgtacaaagaagaattctcaaa 172  Q
      | ||||| ||||| || ||||| || |||| || ||||||||| |||||||| |||| |||||||||    
913 aggttcataaagctgggcctcattcaccttcctttcaagatcaccaacgtacaatgaagcattctcaaa 845  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 137487 times since January 2019
Visitors: 1448