View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1613_high_14 (Length: 237)

Name: NF1613_high_14
Description: NF1613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF1613_high_14
[»] chr5 (1 HSPs)
chr5 (1-219)||(7077451-7077671)

Alignment Details
Target: chr5 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr5

Target: chr5; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 7077451 - 7077671
1 cctactgatgtaaaggcataactaaaattaattgttagtaaatatagcggaaacccaaaccttcagatgttaagcaaccaaaaccttacagttttgcttt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
7077451 cctactgatgtaaaggcataactaaaattaattgttagtaaatatagcggaaacccaaaccttcagatgttaagcaaccaaaaccttgcagttttgcttt 7077550  T
101 aaaattaagcttcgtggctctc--ctacatcaccaaaccatagtctcgtctagtttccctcgttattggttgaaaaggtttaaacccatttaataatttg 198  Q
    ||||||||||||||||||||||  ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
7077551 aaaattaagcttcgtggctctcctctacatcaccaaaccttagtctcgtctagtttccctcgttattggttgaaaaggtttaaactcatttaataatttg 7077650  T
199 aatatccttaaattagtgaat 219  Q
    ||||| ||| ||| |||||||    
7077651 aatatactttaatgagtgaat 7077671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 137019 times since January 2019
Visitors: 1444