View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1613_high_16 (Length: 230)

Name: NF1613_high_16
Description: NF1613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1613_high_16
NF1613_high_16
[»] chr1 (2 HSPs)
chr1 (1-132)||(31809023-31809154)
chr1 (155-219)||(31809167-31809231)


Alignment Details
Target: chr1 (Bit Score: 116; Significance: 4e-59; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 1 - 132
Target Start/End: Original strand, 31809023 - 31809154
Alignment:
1 ataagaaagtatagtcaactgaataatactacattgatttcatttcagttttcatacaaatcaaaccacaagtaatttttgtttcttaagttggtaacat 100  Q
    |||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
31809023 ataagagagtatagtcaactgaattatactacattgatttcatttcagttttcatacaaaccaaaccacaagtaatttttgtttcttaagttggtaacat 31809122  T
101 ttctgtcctccttaaagttaccttcaaaaagc 132  Q
    ||||||||||||||| ||||||||||||||||    
31809123 ttctgtcctccttaacgttaccttcaaaaagc 31809154  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 155 - 219
Target Start/End: Original strand, 31809167 - 31809231
Alignment:
155 gcagcctcttatcctatactggcctcacacaaaggnnnnnnnnngctgccttgtttgttgtttct 219  Q
    |||||||||||||||||||||||||||||||||||         |||||||||||||||||||||    
31809167 gcagcctcttatcctatactggcctcacacaaaggtttttttttgctgccttgtttgttgtttct 31809231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 137293 times since January 2019
Visitors: 1446