View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1613_high_3 (Length: 445)

Name: NF1613_high_3
Description: NF1613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1613_high_3
NF1613_high_3
[»] chr6 (3 HSPs)
chr6 (18-311)||(14407824-14408117)
chr6 (366-445)||(14408227-14408306)
chr6 (132-184)||(14397793-14397845)


Alignment Details
Target: chr6 (Bit Score: 270; Significance: 1e-151; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 18 - 311
Target Start/End: Original strand, 14407824 - 14408117
Alignment:
18 aagaatcccgacacaatattaaagaatcccgacttaaccatgacataaaaacataatttaattactggggttttactcagaaaaaggaatttactttact 117  Q
    ||||||||| ||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14407824 aagaatcccaacacagtattaaagaatcccgactcaaccatgacataaaaacataatttaattactggggttttactcagaaaaaggaatttactttact 14407923  T
118 ccttttgtaattagagtcataaaaatcaattaagaattgcaacaagttgggaaaatcttaacaactttagtagtcacgatgccaaggtttatgatatttc 217  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14407924 ccttatgtaattagagtcataaaaatcaattaagaattgcaacaagttgggaaaatcttaacaactttagtagtcacgatgccaaggtttatgatatttc 14408023  T
218 cacaatcacttcattaacgcaattgcagacgtattacttgacagcaactttcaacacaaacaaagaatttctaccacgatttaaatgacaaata 311  Q
    ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||    
14408024 cacaatcacttcattaacgcaattgcagacgtattacttgacaacaactttcaacacaaacaaagagtttctaccacgatttaaatgacaaata 14408117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 366 - 445
Target Start/End: Original strand, 14408227 - 14408306
Alignment:
366 cttttactacttcagaaaaaataagtgtacattagtaatcatatatagtcatcaaatttaattaagatttgcaataagtt 445  Q
    |||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
14408227 cttttactacttcagaaaaaataattgtactttagtaatcatatatagtcatcaaatttaattaagatttgcaataagtt 14408306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 132 - 184
Target Start/End: Original strand, 14397793 - 14397845
Alignment:
132 agtcataaaaatcaattaagaattgcaacaagttgggaaaatcttaacaactt 184  Q
    |||||||||||||||| ||||||||||| |||||| |||||||| ||||||||    
14397793 agtcataaaaatcaatcaagaattgcaataagttgtgaaaatctaaacaactt 14397845  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 137362 times since January 2019
Visitors: 1446