View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1613_high_4 (Length: 441)

Name: NF1613_high_4
Description: NF1613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1613_high_4
NF1613_high_4
[»] chr1 (3 HSPs)
chr1 (1-430)||(1857617-1858050)
chr1 (1-193)||(1869215-1869408)
chr1 (1-236)||(1843606-1843828)


Alignment Details
Target: chr1 (Bit Score: 376; Significance: 0; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 376; E-Value: 0
Query Start/End: Original strand, 1 - 430
Target Start/End: Original strand, 1857617 - 1858050
Alignment:
1 atggagatatcagatatgacagcttgaaagatcacgtactgataacattggatgatggcagatgattgttagaagacaaaatgcagttccatttcattac 100  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1857617 atggagatatcggatatgacagcttgaaagatcacgtactgataacattggatgatggcagatgattgttagaagacaaaatgcagttccatttcattac 1857716  T
101 tttaggagtttttgcatacaaatttcagtttata----attctaatgtaatttgttttatatattgtgttgtgtgcatgtaatccagtttttaatgannn 196  Q
    ||||||||||||||||||||||||||||||||||    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       
1857717 tttaggagtttttgcatacaaatttcagtttatatataattctaatgtaatttgttttatatattgtgttgtgtgcatgtaatccagtttttaatgattt 1857816  T
197 nnnnaagtgtagagactgagatggaagtgttctttaataataagaaatcacttaccaaattttaccgtaaaaatcacaattaacacataaatgatcatta 296  Q
        |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
1857817 ttttaagtgtagagactgagatggaagtgttctttaataataagaaatcactgaccaaattttaccgtaaaaatcacaattaacacataaatgatcatta 1857916  T
297 tcctgattcaatacacaacctcccgtacaagattgatcattgggtgatagcacacaccaccaaattaagttgtctctagtttgaacctggtaaagaagca 396  Q
    | ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1857917 ttctgattcaatacataacctcccgtacaagattgatcattgggtgatagcacacaccaccaaattaagttgtctctagtttgaacctggtaaagaagca 1858016  T
397 aacgtcacgcaaagagagatatttttgaaggaac 430  Q
    |||||||||||||||||||||||||| |||||||    
1858017 aacgtcacgcaaagagagatatttttaaaggaac 1858050  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 154; E-Value: 2e-81
Query Start/End: Original strand, 1 - 193
Target Start/End: Original strand, 1869215 - 1869408
Alignment:
1 atggagatatcagatatgacagcttgaaagatcacgtactgataacattggatgatggcagatgattgttagaagacaaaatgcagtt-ccatttcatta 99  Q
    ||||||||||| ||||||||||||||||||| || ||||||||| |||||||||||||||||||||||||| |||||||||||||||  |||||||||||    
1869215 atggagatatcggatatgacagcttgaaagaccatgtactgatagcattggatgatggcagatgattgttataagacaaaatgcagtaaccatttcatta 1869314  T
100 ctttaggagtttttgcatacaaatttcagtttataattctaatgtaatttgttttatatattgtgttgtgtgcatgtaatccagtttttaatga 193  Q
     ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
1869315 ttttaggagtttttgcatacaaatttcagtttataattctaatgtaatttgttttatataatgtgttgtgtgcatgtaatccagtttttaatga 1869408  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 111; E-Value: 7e-56
Query Start/End: Original strand, 1 - 236
Target Start/End: Original strand, 1843606 - 1843828
Alignment:
1 atggagatatcagatatgacagcttgaaagatcacgtactgataacattggatgatggcagatgattgttagaagacaaaatgcagt-tccatttcatta 99  Q
    ||||||||||| ||||||||||||||||||| || ||||||||| |||||||||||||||||||||||||  |||||||||||||||  |||||||||||    
1843606 atggagatatcggatatgacagcttgaaagaccatgtactgatagcattggatgatggcagatgattgttttaagacaaaatgcagtaaccatttcatta 1843705  T
100 ctttaggagtttttgcatacaaatttcagtttataattctaatgtaatttgttttatatattgtgttgtgtgcatgtaatccagtttttaatgannnnnn 199  Q
     ||||||||||||||||||||||||||||||||||||| |||| |||||| |             |||||||||||||||||||||||||||||          
1843706 ttttaggagtttttgcatacaaatttcagtttataattttaatttaatttat-------------ttgtgtgcatgtaatccagtttttaatga-ttgta 1843791  T
200 naagtgtagagactgagatggaagtgttctttaataa 236  Q
     ||||||||||||||||||||||||||||| ||||||    
1843792 taagtgtagagactgagatggaagtgttctataataa 1843828  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 137280 times since January 2019
Visitors: 1446