View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1613_high_5 (Length: 412)

Name: NF1613_high_5
Description: NF1613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1613_high_5
NF1613_high_5
[»] chr1 (1 HSPs)
chr1 (26-412)||(36635759-36636145)
[»] chr2 (2 HSPs)
chr2 (231-338)||(39998468-39998575)
chr2 (138-181)||(39998381-39998424)


Alignment Details
Target: chr1 (Bit Score: 375; Significance: 0; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 375; E-Value: 0
Query Start/End: Original strand, 26 - 412
Target Start/End: Complemental strand, 36636145 - 36635759
Alignment:
26 ttcatctccgttcttctctcgttttcttcactgccacgcaatggcaagaaccgcctctcaatcatctcaatctgcatcttccggtgccacgacacgacca 125  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36636145 ttcatctccgttcttctctcgttttcttcactgccacgcaatggcaagaaccgcctctcaatcatctcaatctgcatcttccggtgccacgacacgacca 36636046  T
126 ggtgtcatggcaccacgcggctccgctgccgctacagccggtatgcgtcgtcgccgcccaacaggtggaaacactaccagctccacctctgccgcaggaa 225  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
36636045 ggtgtcatggcaccacgcggctccgctgccgctacagccggtatgcgtcgtcgccgtccaacaggtggaaacactaccagctccacctctgccgcaggaa 36635946  T
226 gctccagcggagggaacaacatgctgcgattctacactgacgatgcacctggtttgaagatttctccgacggtggttctcgtgatgagtctcggcttcat 325  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36635945 gctccagcggagggaacaacatgctgcgattctacaccgacgatgcacctggtttgaagatttctccgacggtggttctcgtgatgagtctcggcttcat 36635846  T
326 tggtttcgtcaccatgctccatgtttttggcaaactctaccgttaccaatctggtcctggtgctggtgcaggcgccggtgcttgatt 412  Q
    ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
36635845 tggtttcgtcaccatgctccatgtttttggcaaactctaccgttatcaatctggtcctggtgctggtgcaggcgccggtgcttgatt 36635759  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 68; Significance: 3e-30; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 231 - 338
Target Start/End: Original strand, 39998468 - 39998575
Alignment:
231 agcggagggaacaacatgctgcgattctacactgacgatgcacctggtttgaagatttctccgacggtggttctcgtgatgagtctcggcttcattggtt 330  Q
    |||||||| | |||||||||| ||||||||||||| |||||||||||||||||||||||||| ||||| ||| | || ||||||||| ||||||||||||    
39998468 agcggaggaagcaacatgctgagattctacactgatgatgcacctggtttgaagatttctcctacggttgttttggttatgagtctctgcttcattggtt 39998567  T
331 tcgtcacc 338  Q
    ||||||||    
39998568 tcgtcacc 39998575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 138 - 181
Target Start/End: Original strand, 39998381 - 39998424
Alignment:
138 ccacgcggctccgctgccgctacagccggtatgcgtcgtcgccg 181  Q
    |||||||||||||||||||| || ||||| ||||||||||||||    
39998381 ccacgcggctccgctgccgccactgccggcatgcgtcgtcgccg 39998424  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 137184 times since January 2019
Visitors: 1446