View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1613_high_8 (Length: 339)

Name: NF1613_high_8
Description: NF1613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF1613_high_8
[»] chr2 (6 HSPs)
chr2 (16-329)||(35280012-35280325)
chr2 (16-329)||(35289357-35289670)
chr2 (16-313)||(35275245-35275542)
chr2 (21-329)||(35322164-35322469)
chr2 (107-329)||(35307246-35307468)
chr2 (107-329)||(35311589-35311814)

Alignment Details
Target: chr2 (Bit Score: 278; Significance: 1e-155; HSPs: 6)
Name: chr2

Target: chr2; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 16 - 329
Target Start/End: Original strand, 35280012 - 35280325
16 tcatcttcaccatagcaaaagcaaagtctcttctaaaagcaaaaccatttatactataagccctaaccaaagaaactggagaaccaacaccattgaaaag 115  Q
35280012 tcatcttcaccatagcaaaagcaaagtctcttctaaaagcaaaaccatttatactataagccctaaccaaagaaactggagaaccaacaccattgaaaag 35280111  T
116 tgcttgatcagaatgaagaagtcctttattagcaacaaggtccctatagtaattattgtcaaaagtaactggagagacagaatcaagaggtgccaaattt 215  Q
    |||||||||||||| ||||||||||||||||||||| || |||||||| ||||| |||||||||||||| |||||||||||||||||||| |||||||||    
35280112 tgcttgatcagaattaagaagtcctttattagcaactagatccctataataattgttgtcaaaagtaacaggagagacagaatcaagaggagccaaattt 35280211  T
216 gtgtcaccaccagaaagaggacagtttgcttttcttaaggttgcaaagtttgtgtcgatgtttgtttcattgtatatgcgatttcggaaaaattgacatt 315  Q
    |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
35280212 gtgtcaccgccagaaagaggacagtttgcttttcttaaggttgcaaagtttgtgtcgatgttggtttcattgtatatgcgatttcggaaaaattgacatt 35280311  T
316 ctgcttggcctatg 329  Q
35280312 ctgcttggcctatg 35280325  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 16 - 329
Target Start/End: Original strand, 35289357 - 35289670
16 tcatcttcaccatagcaaaagcaaagtctcttctaaaagcaaaaccatttatactataagccctaaccaaagaaactggagaaccaacaccattgaaaag 115  Q
    |||||||||||||||||   |||||||||||| ||||||||| |  |||| ||||||||| |||||||||||||||| ||||||||||||||||||||||    
35289357 tcatcttcaccatagcagctgcaaagtctcttttaaaagcaatattatttctactataagtcctaaccaaagaaacttgagaaccaacaccattgaaaag 35289456  T
116 tgcttgatcagaatgaagaagtcctttattagcaacaaggtccctatagtaattattgtcaaaagtaactggagagacagaatcaagaggtgccaaattt 215  Q
     |||||||||||||||||||||||||||||||||||||||||  |||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
35289457 agcttgatcagaatgaagaagtcctttattagcaacaaggtcattatagtaattgttgtcaaaagtaactggagagacagaatcaagaggtgccaaattt 35289556  T
216 gtgtcaccaccagaaagaggacagtttgcttttcttaaggttgcaaagtttgtgtcgatgtttgtttcattgtatatgcgatttcggaaaaattgacatt 315  Q
     ||||||||||||||  |||||| |||| ||||||||||||||||||||||||||| ||||| ||||| |||||||| ||| ||| ||||||||||||||    
35289557 atgtcaccaccagaagtaggacaatttgattttcttaaggttgcaaagtttgtgtcaatgttggtttcgttgtatatacgagttctgaaaaattgacatt 35289656  T
316 ctgcttggcctatg 329  Q
    ||||||| ||||||    
35289657 ctgcttgacctatg 35289670  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 16 - 313
Target Start/End: Original strand, 35275245 - 35275542
16 tcatcttcaccatagcaaaagcaaagtctcttctaaaagcaaaaccatttatactataagccctaaccaaagaaactggagaaccaacaccattgaaaag 115  Q
    |||||||||||||||||  ||||||||||||   |||||||  ||||| | |||||||   |||||||||||||| | |||||||| |||||||||||||    
35275245 tcatcttcaccatagcagcagcaaagtctctagaaaaagcagcaccatctctactatacttcctaaccaaagaaatttgagaaccaccaccattgaaaag 35275344  T
116 tgcttgatcagaatgaagaagtcctttattagcaacaaggtccctatagtaattattgtcaaaagtaactggagagacagaatcaagaggtgccaaattt 215  Q
      ||||||||||||| ||||| ||||||||||||| ||||||| |||| ||||| ||||||||  ||  ||||| |||||||||||  ||||| |||||     
35275345 aacttgatcagaatgtagaagacctttattagcaataaggtccttataataattgttgtcaaatttagttggagtgacagaatcaaagggtgctaaattg 35275444  T
216 gtgtcaccaccagaaagaggacagtttgcttttcttaaggttgcaaagtttgtgtcgatgtttgtttcattgtatatgcgatttcggaaaaattgaca 313  Q
    ||||||||||||||   ||| || |||  |||||||||||| || |||||| |||| ||||| | |||||||| ||||||||||| ||||||||||||    
35275445 gtgtcaccaccagaggtagggcaatttctttttcttaaggtagccaagtttctgtcaatgttggcttcattgtgtatgcgatttctgaaaaattgaca 35275542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 21 - 329
Target Start/End: Original strand, 35322164 - 35322469
21 ttcaccatagcaaaagcaaagtctcttctaaaagcaaaaccatttatactataagccctaaccaaagaaactggagaaccaacaccattgaaaagtgctt 120  Q
    ||||||||||||| |||||||||||||||||||| |  ||||||  ||||||||  ||||||||||  | || |||| |||  |   |||||||| ||||    
35322164 ttcaccatagcaacagcaaagtctcttctaaaagtagcaccattggtactataactcctaaccaaattatcttgagacccatta---ttgaaaagagctt 35322260  T
121 gatcagaatgaagaagtcctttattagcaacaaggtccctatagtaattattgtcaaaagtaactggagagacagaatcaagaggtgccaaatttgtgtc 220  Q
    |||||||||| | ||| |||||  | |||||||| |   |||||||||| ||||||||| |   ||||| || ||  ||||||||||| ||||| |||||    
35322261 gatcagaatggaaaagacctttgcttgcaacaagatttttatagtaattgttgtcaaaatttgttggagtgagagtgtcaagaggtgctaaattggtgtc 35322360  T
221 accaccagaaagaggacagtttgcttttcttaaggttgcaaagtttgtgtcgatgtttgtttcattgtatatgcgatttcggaaaaattgacattctgct 320  Q
    |||||||||||||||||| |||  ||| ||||||||||||||||||||||| ||||| |||||||||||||||||||||| ||||||||| || ||| ||    
35322361 accaccagaaagaggacaatttaatttccttaaggttgcaaagtttgtgtcaatgttggtttcattgtatatgcgatttctgaaaaattggcactctcct 35322460  T
321 tggcctatg 329  Q
35322461 tggcctatg 35322469  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 99; E-Value: 8e-49
Query Start/End: Original strand, 107 - 329
Target Start/End: Original strand, 35307246 - 35307468
107 attgaaaagtgcttgatcagaatgaagaagtcctttattagcaacaaggtccctatagtaattattgtcaaaagtaactggagagacagaatcaagaggt 206  Q
    ||||||||| |||||||||||||| | ||| |||||  | ||||||||||   |||||||||| || |||||| |   ||||| || || |||||| |||    
35307246 attgaaaagagcttgatcagaatggaaaagacctttgcttgcaacaaggtttttatagtaattgttatcaaaacttgttggagtgagagtatcaagtggt 35307345  T
207 gccaaatttgtgtcaccaccagaaagaggacagtttgcttttcttaaggttgcaaagtttgtgtcgatgtttgtttcattgtatatgcgatttcggaaaa 306  Q
    || ||||| ||||||||||||||||||||||| |||| ||| ||||||||||||||||||||||| ||||| |||||||||||||||||||||| |||||    
35307346 gctaaattggtgtcaccaccagaaagaggacaatttgatttccttaaggttgcaaagtttgtgtcaatgttggtttcattgtatatgcgatttctgaaaa 35307445  T
307 attgacattctgcttggcctatg 329  Q
    |||| || ||| |||||||||||    
35307446 attggcactctccttggcctatg 35307468  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 107 - 329
Target Start/End: Original strand, 35311589 - 35311814
107 attgaaaagtgcttgatcagaatgaagaagtcctttattagcaacaaggtccctatagtaattattgtcaaaagtaactggagagacagaatcaagaggt 206  Q
    |||||||||  ||||||||||||| |  || |||||  | ||||||||||   |||| ||||| ||||||||| |   ||||| || || |||||| |||    
35311589 attgaaaaggacttgatcagaatggaatagacctttgcttgcaacaaggtttttataataattgttgtcaaaacttgttggagtgagagtatcaagtggt 35311688  T
207 gccaaatttgtgtcac---caccagaaagaggacagtttgcttttcttaaggttgcaaagtttgtgtcgatgtttgtttcattgtatatgcgatttcgga 303  Q
    || ||||| ||||||    ||| ||||| || |||||| | ||||||||||||||| ||||||||||| ||||| |||||||||||||||||| ||| ||    
35311689 gctaaattggtgtcattgtcactagaaaaagaacagttggattttcttaaggttgcgaagtttgtgtcaatgttggtttcattgtatatgcgagttctga 35311788  T
304 aaaattgacattctgcttggcctatg 329  Q
    | ||| |||| ||| |||||||||||    
35311789 acaatcgacactctccttggcctatg 35311814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 136898 times since January 2019
Visitors: 1443