View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1613_high_9 (Length: 338)

Name: NF1613_high_9
Description: NF1613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1613_high_9
NF1613_high_9
[»] chr4 (1 HSPs)
chr4 (8-321)||(13205915-13206227)


Alignment Details
Target: chr4 (Bit Score: 290; Significance: 1e-163; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 290; E-Value: 1e-163
Query Start/End: Original strand, 8 - 321
Target Start/End: Complemental strand, 13206227 - 13205915
Alignment:
8 gagaagaagtaaattcgacggttgatttctttttctacaaagtaaattgttataaccattttgatcaagatgttatttggatattctcaagtttttccta 107  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13206227 gagaagaagtaaattcgacagttgatttctttttctacaaagtaaattgttataaccattttgatcaagatgttatttggatattctcaagtttttccta 13206128  T
108 agctaaatctactctactatgtgtgttgccaaaaacatcttgttccaagatttttagaaaaggctttaagatcttgagctttttgtgaaacttatgcata 207  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||    
13206127 agctaaatctactctactatgtgtgttgccaaaaacatcttgttccaagatttt-agaaaaggctttaagatcttgagctttttgtgaagcttatgcata 13206029  T
208 agagaaatagaaattgagatgtttcaactagaagctatcaaatcctcacaattgggattggtgttcgaagttataaagaacttaaatcttgagacaatat 307  Q
    ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
13206028 agagaaatagaaattgagatgttccaactagaagctatcaaatcctcacaattgggattggtgttccaagttataaagaacttaaatcttgagacaatat 13205929  T
308 taataggactatat 321  Q
    ||||||||||||||    
13205928 taataggactatat 13205915  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 136787 times since January 2019
Visitors: 1443