View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1613_low_10 (Length: 368)

Name: NF1613_low_10
Description: NF1613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1613_low_10
NF1613_low_10
[»] chr5 (18 HSPs)
chr5 (14-368)||(11048909-11049263)
chr5 (18-368)||(10217001-10217353)
chr5 (24-368)||(10740951-10741295)
chr5 (24-364)||(10763389-10763729)
chr5 (39-364)||(10717196-10717521)
chr5 (58-368)||(10564674-10564984)
chr5 (47-368)||(10604388-10604709)
chr5 (18-364)||(10611317-10611663)
chr5 (35-367)||(10747268-10747600)
chr5 (130-368)||(19606117-19606355)
chr5 (37-368)||(10580617-10580961)
chr5 (138-364)||(10558629-10558855)
chr5 (170-364)||(7192764-7192958)
chr5 (175-368)||(9836580-9836773)
chr5 (143-250)||(10588800-10588907)
chr5 (180-364)||(10652458-10652642)
chr5 (179-364)||(10660341-10660526)
chr5 (335-368)||(10745864-10745897)
[»] chr2 (1 HSPs)
chr2 (18-368)||(17923655-17924005)
[»] chr6 (5 HSPs)
chr6 (18-364)||(12948251-12948597)
chr6 (18-368)||(12957685-12958035)
chr6 (18-368)||(12931886-12932236)
chr6 (18-368)||(12906797-12907147)
chr6 (18-368)||(12899177-12899527)
[»] chr3 (1 HSPs)
chr3 (43-95)||(31467687-31467739)


Alignment Details
Target: chr5 (Bit Score: 322; Significance: 0; HSPs: 18)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 322; E-Value: 0
Query Start/End: Original strand, 14 - 368
Target Start/End: Complemental strand, 11049263 - 11048909
Alignment:
14 caaaggtagaaaacatgcaacacaccataatttcaggttggtatcagtgatagttagtgtggtttcttttcttatcatactttcattcattataattatc 113  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
11049263 caaaggtagaaaacatgcaacaaaccataatttcaggttggtatcagtgatagttagtgtggtttcttttcttatcatactttcatttattataattatc 11049164  T
114 acctggatgnnnnnnngaaaccaaaaaccatcttttgattcaccaacaattgatcaactagctaaagtttcataccaagatttacatcaaggaaccgatg 213  Q
    |||||||||       ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
11049163 acctggatgaaaaaaagaaaccaaaaaccatcttttgattcaccaacaattgatcaactagataaagtttcataccaagatttacatcaaggaaccgatg 11049064  T
214 gattctcagataaaaacttgattggatcaggaggtttcggttctgtgtacagaggaaatcttgtgtcggaaggtaatgttgttgctgtgaaagtcttcaa 313  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11049063 gattctcagataaaaacttgattggatcaggaggtttcggttctgtgtacagaggaaatcttgtgtcggaaggtaatgttgttgctgtgaaagtcttcaa 11048964  T
314 cctccaaaacaatggagctagcaagagtttcattgttgaatgtaatgcactcaaa 368  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11048963 cctccaaaacaatggagctagcaagagtttcattgttgaatgtaatgcactcaaa 11048909  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 18 - 368
Target Start/End: Complemental strand, 10217353 - 10217001
Alignment:
18 ggtagaaaacatgcaacacaccataatttcaggttggtatcagtga--tagttagtgtggtttcttttcttatcatactttcattcattataattatcac 115  Q
    ||||| |||||||||||| || |||||| ||||||| |||||||||  ||||||||||||||||||||||||||||||||||||| ||||||||||||||    
10217353 ggtaggaaacatgcaacaaactataattccaggttgatatcagtgagatagttagtgtggtttcttttcttatcatactttcatttattataattatcac 10217254  T
116 ctggatgnnnnnnngaaaccaaaaaccatcttttgattcaccaacaattgatcaactagctaaagtttcataccaagatttacatcaaggaaccgatgga 215  Q
     ||||||       |||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||| |||||     
10217253 ttggatgaaaaaaagaaaccaaaatccatcttttgattcaccaacaatcgatcaactagctaaagtttcataccaagacttacatcaaggaactgatggg 10217154  T
216 ttctcagataaaaacttgattggatcaggaggtttcggttctgtgtacagaggaaatcttgtgtcggaaggtaatgttgttgctgtgaaagtcttcaacc 315  Q
    ||||| |||||||||||||||||||||||| |||| |||| |||||| || || ||||||||||| |||| |||||||||||||||||| ||| | ||||    
10217153 ttctcggataaaaacttgattggatcaggaagttttggttgtgtgtatagcgggaatcttgtgtcagaagttaatgttgttgctgtgaaggtcctaaacc 10217054  T
316 tccaaaacaatggagctagcaagagtttcattgttgaatgtaatgcactcaaa 368  Q
    ||||||| |||||||||||||||||||| ||||||||||||||||||||||||    
10217053 tccaaaagaatggagctagcaagagttttattgttgaatgtaatgcactcaaa 10217001  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 24 - 368
Target Start/End: Complemental strand, 10741295 - 10740951
Alignment:
24 aaacatgcaacacaccataatttcaggttggtatcagtgatagttagtgtggtttcttttcttatcatactttcattcattataattatcacctggatgn 123  Q
    |||||||||| | | |||||||||| |||| || ||||||||||||| ||| ||||||||||  |||||||||||||  ||||   ||||  |||||||     
10741295 aaacatgcaaaaaaacataatttcaagttgatagcagtgatagttagcgtgatttcttttctgctcatactttcatttgttatttctatctgctggatga 10741196  T
124 nnnnnngaaaccaaaaaccatcttttgattcaccaacaattgatcaactagctaaagtttcataccaagatttacatcaaggaaccgatggattctcaga 223  Q
          |||||||||| ||||| |||||||||||||| ||||||||||||||||| |||||||| ||||| ||||| | |||||||||||| ||||||||    
10741195 ggaagagaaaccaaaacccatcctttgattcaccaactattgatcaactagctaaggtttcatatcaagacttacaccgaggaaccgatgggttctcaga 10741096  T
224 taaaaacttgattggatcaggaggtttcggttctgtgtacagaggaaatcttgtgtcggaaggtaatgttgttgctgtgaaagtcttcaacctccaaaac 323  Q
     | ||||||||| ||||||||| |||| ||||||||||||| ||||||||||||| | ||||  ||||||||||| || || ||||| |||||| ||||     
10741095 aagaaacttgatcggatcaggaagttttggttctgtgtacaaaggaaatcttgtgacagaagacaatgttgttgccgtaaaggtcttgaacctcaaaaag 10740996  T
324 aatggagctagcaagagtttcattgttgaatgtaatgcactcaaa 368  Q
    || ||||||  ||||||||||||||||||||||||||||||||||    
10740995 aagggagctcacaagagtttcattgttgaatgtaatgcactcaaa 10740951  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 24 - 364
Target Start/End: Complemental strand, 10763729 - 10763389
Alignment:
24 aaacatgcaacacaccataatttcaggttggtatcagtgatagttagtgtggtttcttttcttatcatactttcattcattataattatcacctggatgn 123  Q
    |||||||||| ||  || || ||||||||| || ||||||||||||| ||||||||||||||| ||||||||||||| || |||| ||||  ||| ||      
10763729 aaacatgcaaaacgacacaagttcaggttgatagcagtgatagttagcgtggtttcttttcttctcatactttcatttatcataactatctactgcataa 10763630  T
124 nnnnnngaaaccaaaaaccatcttttgattcaccaacaattgatcaactagctaaagtttcataccaagatttacatcaaggaaccgatggattctcaga 223  Q
          |||| | ||| | |||||||||||||||||||||||| ||||||| ||| |||||||||||||| ||||  |||||||| ||||| ||||| ||    
10763629 ggaaaagaaatccaaagcgatcttttgattcaccaacaattgagcaactagataaggtttcataccaagagttactccaaggaacagatgggttctcgga 10763530  T
224 taaaaacttgattggatcaggaggtttcggttctgtgtacagaggaaatcttgtgtcggaaggtaatgttgttgctgtgaaagtcttcaacctccaaaac 323  Q
    ||||||| |||| ||||||||| |||  |||  |||||||||||||||||||||||| ||||  ||| |||||||| | |||||||||||||||||||||    
10763529 taaaaacctgatcggatcaggaagttctggtgatgtgtacagaggaaatcttgtgtcagaagacaatattgttgctataaaagtcttcaacctccaaaac 10763430  T
324 aatggagctagcaagagtttcattgttgaatgtaatgcact 364  Q
    |||||||||  ||||||||||||||||||||||||||||||    
10763429 aatggagctcacaagagtttcattgttgaatgtaatgcact 10763389  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 141; E-Value: 7e-74
Query Start/End: Original strand, 39 - 364
Target Start/End: Complemental strand, 10717521 - 10717196
Alignment:
39 cataatttcaggttggtatcagtgatagttagtgtggtttcttttcttatcatactttcattcattataattatcacctggatgnnnnnnngaaaccaaa 138  Q
    |||||||||| |||| || |||||||| |||||||| ||| |||| |  |||||||||||||  ||||   ||||  |||||||       |||||||||    
10717521 cataatttcaagttgatagcagtgatatttagtgtgattttttttttgctcatactttcatttgttatttctatctgctggatgaggaagagaaaccaaa 10717422  T
139 aaccatcttttgattcaccaacaattgatcaactagctaaagtttcataccaagatttacatcaaggaaccgatggattctcagataaaaacttgattgg 238  Q
    ||||||| |||||||||||||| ||||||||||||||||| |||||||| ||||| ||||| | |||||||||||| |||||||| | ||||||||||||    
10717421 aaccatcctttgattcaccaactattgatcaactagctaaggtttcatatcaagacttacaccgaggaaccgatgggttctcagaaagaaacttgattgg 10717322  T
239 atcaggaggtttcggttctgtgtacagaggaaatcttgtgtcggaaggtaatgttgttgctgtgaaagtcttcaacctccaaaacaatggagctagcaag 338  Q
    ||||||| |||| ||||||||||||| ||||||||||||||| ||||  ||||||||||| || || ||||| |||||| |||| || ||||||  ||||    
10717321 atcaggaagttttggttctgtgtacaaaggaaatcttgtgtcagaagacaatgttgttgccgtaaaggtcttgaacctcaaaaagaagggagctcacaag 10717222  T
339 agtttcattgttgaatgtaatgcact 364  Q
    ||||||||||||||||||||||||||    
10717221 agtttcattgttgaatgtaatgcact 10717196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 138; E-Value: 5e-72
Query Start/End: Original strand, 58 - 368
Target Start/End: Original strand, 10564674 - 10564984
Alignment:
58 cagtgatagttagtgtggtttcttttcttatcatactttcattcattataattatcacctggatgnnnnnnngaaaccaaaaaccatcttttgattcacc 157  Q
    |||||||| |||||||||||||||||||| ||||||||||||| || |||| ||||  |||||||       |||| | ||| | ||||| |||||||||    
10564674 cagtgataattagtgtggtttcttttcttctcatactttcatttatcataactatctactggatgaggaaaagaaatccaaagcgatcttgtgattcacc 10564773  T
158 aacaattgatcaactagctaaagtttcataccaagatttacatcaaggaaccgatggattctcagataaaaacttgattggatcaggaggtttcggttct 257  Q
    |||| ||||||||||| |||| ||||| |||||||| |||||||||||||||||||| ||||||  || ||||||||| ||||||||| |||| |||  |    
10564774 aacagttgatcaactatctaaggtttcgtaccaagaattacatcaaggaaccgatgggttctcaactagaaacttgataggatcaggaagttttggtctt 10564873  T
258 gtgtacagaggaaatcttgtgtcggaaggtaatgttgttgctgtgaaagtcttcaacctccaaaacaatggagctagcaagagtttcattgttgaatgta 357  Q
    ||||||| ||||||||||||||| |||| |||||||||||| || || ||| | ||||||||||| || ||||||  |||||||||||||||||||||||    
10564874 gtgtacaaaggaaatcttgtgtcagaagataatgttgttgccgtaaaggtcctgaacctccaaaagaagggagctcacaagagtttcattgttgaatgta 10564973  T
358 atgcactcaaa 368  Q
    |||||||||||    
10564974 atgcactcaaa 10564984  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 47 - 368
Target Start/End: Original strand, 10604388 - 10604709
Alignment:
47 caggttggtatcagtgatagttagtgtggtttcttttcttatcatactttcattcattataattatcacctggatgnnnnnnngaaaccaaaaaccatct 146  Q
    ||||||| || ||||||||||| ||||||| ||||||||| ||||||||||| | || |||  ||||   ||| ||       |||||||||| ||||||    
10604388 caggttgatagcagtgatagttggtgtggtgtcttttcttttcatactttcagttatcatagctatctattgggtgaggaaaagaaaccaaaacccatct 10604487  T
147 tttgattcaccaacaattgatcaactagctaaagtttcataccaagatttacatcaaggaaccgatggattctcagataaaaacttgattggatcaggag 246  Q
    |||||||||||| ||||| ||||||||| ||| ||||||||||| || ||||| |||||||||||||| ||||| |||| |||||||||||||| ||||     
10604488 tttgattcaccagcaattcatcaactagataaggtttcataccatgacttacaccaaggaaccgatgggttctcggatagaaacttgattggattaggaa 10604587  T
247 gtttcggttctgtgtacagaggaaatcttgtgtcggaaggtaatgttgttgctgtgaaagtcttcaacctccaaaacaatggagctagcaagagtttcat 346  Q
    |||| ||||||||||||||||||||||||||||| |||| |||||| |||||||| || ||| | ||||||||||| || |||||   ||||| ||||||    
10604588 gttttggttctgtgtacagaggaaatcttgtgtcagaagataatgtagttgctgtaaaggtcctgaacctccaaaagaagggagcacacaagaatttcat 10604687  T
347 tgttgaatgtaatgcactcaaa 368  Q
    ||||||||||||||||||||||    
10604688 tgttgaatgtaatgcactcaaa 10604709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 126; E-Value: 7e-65
Query Start/End: Original strand, 18 - 364
Target Start/End: Original strand, 10611317 - 10611663
Alignment:
18 ggtagaaaacatgcaacacaccataatttcaggttggtatcagtgatagttagtgtggtttcttttcttatcatactttcattcattataattatcacct 117  Q
    ||||| |||||  ||| ||||||||  |||||| || || |||||||||||||  |||||||||||||| ||||| ||| ||| ||||||| ||||  ||    
10611317 ggtaggaaacacccaaaacaccatatattcaggctgatagcagtgatagttagcatggtttcttttcttctcatatttttatttattataactatctact 10611416  T
118 ggatgnnnnnnngaaaccaaaaaccatcttttgattcaccaacaattgatcaactagctaaagtttcataccaagatttacatcaaggaaccgatggatt 217  Q
    || |         ||| ||||||  |||||| ||||||||| ||| |||||||  |||||| ||||||| || ||| ||| | |||||||||||||| ||    
10611417 gggtaaggaaaataaatcaaaaaagatctttcgattcaccaccaaatgatcaagaagctaaggtttcattccgagacttataccaaggaaccgatgggtt 10611516  T
218 ctcagataaaaacttgattggatcaggaggtttcggttctgtgtacagaggaaatcttgtgtcggaaggtaatgttgttgctgtgaaagtcttcaacctc 317  Q
    |||||||| ||||||||| ||||||||| |||| |||  |||||||||||||||||||||||| ||||  |||||||||||| | || ||||||||||||    
10611517 ctcagatagaaacttgatcggatcaggaagttttggtgatgtgtacagaggaaatcttgtgtcagaagacaatgttgttgctataaaggtcttcaacctc 10611616  T
318 caaaacaatggagctagcaagagtttcattgttgaatgtaatgcact 364  Q
    |||||||||||||||  ||||||||||||||||||||||||||||||    
10611617 caaaacaatggagctcacaagagtttcattgttgaatgtaatgcact 10611663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 108; E-Value: 4e-54
Query Start/End: Original strand, 35 - 367
Target Start/End: Complemental strand, 10747600 - 10747268
Alignment:
35 acaccataatttcaggttggtatcagtgatagttagtgtggtttcttttcttatcatactttcattcattataattatcacctggatgnnnnnnngaaac 134  Q
    ||||||||| |||| ||||||  |||||||||||||||| |||| ||||||| ||||||||||||| ||||||| ||||   ||| |        ||||     
10747600 acaccataaattcatgttggtcgcagtgatagttagtgttgttttttttcttctcatactttcatttattataactatctattgggtaagaaaaagaaat 10747501  T
135 caaaaaccatcttttgattcaccaacaattgatcaactagctaaagtttcataccaagatttacatcaaggaaccgatggattctcagataaaaacttga 234  Q
     | |||  |||| | |||||||| ||||||||||||||||||| ||||||||||||||| |||||||| |||||  | || ||||||  || ||||||||    
10747500 aacaaaagatctatcgattcacctacaattgatcaactagctacagtttcataccaagacttacatcatggaacaaacggtttctcaagtagaaacttga 10747401  T
235 ttggatcaggaggtttcggttctgtgtacagaggaaatcttgtgtcggaaggtaatgttgttgctgtgaaagtcttcaacctccaaaacaatggagctag 334  Q
    | ||||||||| |||| ||||| ||||||| ||||||||||||||| |||  ||||| |||||| || |||||| | ||||| ||||| || ||||||      
10747400 tcggatcaggaagttttggttcagtgtacaaaggaaatcttgtgtccgaaaataatgctgttgccgtaaaagtcctaaaccttcaaaagaagggagctca 10747301  T
335 caagagtttcattgttgaatgtaatgcactcaa 367  Q
    |||||||||||||||||||||||||| ||||||    
10747300 caagagtttcattgttgaatgtaatgtactcaa 10747268  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 130 - 368
Target Start/End: Complemental strand, 19606355 - 19606117
Alignment:
130 gaaaccaaaaaccatcttttgattcaccaacaattgatcaactagctaaagtttcataccaagatttacatcaaggaaccgatggattctcagataaaaa 229  Q
    ||||| ||||||||||||  ||||||||||||||||| ||| || |||  ||||| |||||||| ||| |||| | ||||||||| ||||| |||| |||    
19606355 gaaacaaaaaaccatcttcagattcaccaacaattgaccaattacctatggtttcctaccaagacttatatcaggcaaccgatgggttctcggatagaaa 19606256  T
230 cttgattggatcaggaggtttcggttctgtgtacagaggaaatcttgtgtcggaaggtaatgttgttgctgtgaaagtcttcaacctccaaaacaatgga 329  Q
    |||||||||||||||||| |||||||| ||||| | |||||||||| |||| |||| ||| ||| ||||||| || ||| | |||||  |||| || |||    
19606255 cttgattggatcaggaggcttcggttccgtgtataaaggaaatcttatgtcagaagataaagttattgctgttaaggtcctgaaccttgaaaagaaggga 19606156  T
330 gctagcaagagtttcattgttgaatgtaatgcactcaaa 368  Q
    |||  ||||||||| |||  |||||||||||| ||||||    
19606155 gctcacaagagttttattactgaatgtaatgctctcaaa 19606117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 37 - 368
Target Start/End: Original strand, 10580617 - 10580961
Alignment:
37 accataatttcaggttggtatcagtgatagttagtgtggtttcttttcttatcatactttcattcattataattatcacctggatgnnnnnnngaaacca 136  Q
    |||||||||||| |||| || |  ||||||| |||||||||||||||||| ||||||||||||| ||||||  ||||   |||||        | ||| |    
10580617 accataatttcaagttgatagctatgatagtcagtgtggtttcttttcttctcatactttcatttattatagctatctattggataagtaaaaggaacaa 10580716  T
137 aaaaccatcttttgattcaccaacaattgatcaactagctaaagtttcataccaagatttacatcaaggaaccgatggattctcagataaaaacttgatt 236  Q
    |||| |||| || |||||  ||| ||| |||||||||| ||| ||||||||| |||| |||||  ||||||| ||||| ||||| |||| |||| ||||     
10580717 aaaatcatcattagattcttcaataatagatcaactagataaggtttcatacaaagacttacacaaaggaactgatgggttctcggatagaaacatgatc 10580816  T
237 ggatcaggaggtttcggttctgtgtacagaggaaatcttgtgtcggaag-------------gtaatgttgttgctgtgaaagtcttcaacctccaaaac 323  Q
    || |||||| |||| ||||| ||||||| ||||||||||||||| ||||              |||||||||||| || || ||||| |||||||||||     
10580817 gggtcaggaagttttggttccgtgtacaaaggaaatcttgtgtcagaagataatgttgttgcataatgttgttgcagtaaaggtcttgaacctccaaaag 10580916  T
324 aatggagctagcaagagtttcattgttgaatgtaatgcactcaaa 368  Q
    || ||||||  ||||||||| ||||||||||||||||||||||||    
10580917 aaaggagctcacaagagttttattgttgaatgtaatgcactcaaa 10580961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 138 - 364
Target Start/End: Original strand, 10558629 - 10558855
Alignment:
138 aaaccatcttttgattcaccaacaattgatcaactagctaaagtttcataccaagatttacatcaaggaaccgatggattctcagataaaaacttgattg 237  Q
    ||||||||||  |||||||||| |||||| ||||| ||||  ||||| |||||||| ||  |||| | ||| ||||| ||||||  || |||||||||||    
10558629 aaaccatcttcagattcaccaataattgaccaacttgctatggtttcttaccaagacttgtatcaggcaactgatggcttctcatctagaaacttgattg 10558728  T
238 gatcaggaggtttcggttctgtgtacagaggaaatcttgtgtcggaaggtaatgttgttgctgtgaaagtcttcaacctccaaaacaatggagctagcaa 337  Q
    |||||||||| || ||||| ||||| | |||||||||| |||| |||| ||| ||| |||||||||| ||| |  ||||  |||| |||||||||  |||    
10558729 gatcaggaggctttggttcggtgtataaaggaaatcttatgtcagaagataaagttattgctgtgaaggtcctggaccttgaaaagaatggagctcacaa 10558828  T
338 gagtttcattgttgaatgtaatgcact 364  Q
    |||||| |||   ||||||||||||||    
10558829 gagttttattaccgaatgtaatgcact 10558855  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 170 - 364
Target Start/End: Original strand, 7192764 - 7192958
Alignment:
170 actagctaaagtttcataccaagatttacatcaaggaaccgatggattctcagataaaaacttgattggatcaggaggtttcggttctgtgtacagagga 269  Q
    ||||||||||||||||||||| ||  | || || ||||| || || || || | || ||||||  ||||||||||| | || ||||||||||||| ||||    
7192764 actagctaaagtttcataccaggaccttcaccagggaactgacgggttttctgctagaaacttagttggatcaggaagctttggttctgtgtacaaagga 7192863  T
270 aatcttgtgtcggaaggtaatgttgttgctgtgaaagtcttcaacctccaaaacaatggagctagcaagagtttcattgttgaatgtaatgcact 364  Q
    |||||||  || |||| ||| |||||||| ||||| ||| | ||||| ||||| || ||||||  |||||||||||||| |||||||||||||||    
7192864 aatcttgaatcagaagataaagttgttgccgtgaaggtcatgaaccttcaaaagaagggagctcacaagagtttcattgctgaatgtaatgcact 7192958  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 175 - 368
Target Start/End: Complemental strand, 9836773 - 9836580
Alignment:
175 ctaaagtttcataccaagatttacatcaaggaaccgatggattctcagataaaaacttgattggatcaggaggtttcggttctgtgtacagaggaaatct 274  Q
    |||| ||||||||||||||  ||||||| ||||| ||||  |||||||||| ||| ||||||||||||||| |||| ||| | || |||| ||||||| |    
9836773 ctaaggtttcataccaagaactacatcatggaactgatgagttctcagatagaaatttgattggatcaggaagttttggtaccgtatacaaaggaaatat 9836674  T
275 tgtgtcggaaggtaatgttgttgctgtgaaagtcttcaacctccaaaacaatggagctagcaagagtttcattgttgaatgtaatgcactcaaa 368  Q
    ||| ||  ||| ||| ||||||||| | || ||  | |||||| |||| || ||||||   |||||||| |||| |||||||||||||||||||    
9836673 tgtatcacaagataaagttgttgctataaaggttctgaacctcaaaaagaagggagctcataagagttttattgctgaatgtaatgcactcaaa 9836580  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 143 - 250
Target Start/End: Complemental strand, 10588907 - 10588800
Alignment:
143 atcttttgattcaccaacaattgatcaactagctaaagtttcataccaagatttacatcaaggaaccgatggattctcagataaaaacttgattggatca 242  Q
    ||||| |||| |||| |||| ||| || |||| ||| ||||||||||||||  ||||||||||||| |||||||||||||||  ||||||||||||||||    
10588907 atcttctgatacacctacaactgaccagctagttaaggtttcataccaagaactacatcaaggaactgatggattctcagatggaaacttgattggatca 10588808  T
243 ggaggttt 250  Q
    ||| ||||    
10588807 ggaagttt 10588800  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 180 - 364
Target Start/End: Complemental strand, 10652642 - 10652458
Alignment:
180 gtttcataccaagatttacatcaaggaaccgatggattctcagataaaaacttgattggatcaggaggtttcggttctgtgtacagaggaaatcttgtgt 279  Q
    ||||||||| ||||  | || |||||||| |||||||| || | || |||| || |||||| |||| |||| ||||||||||||| |||||||||||  |    
10652642 gtttcatacaaagaccttcaccaaggaactgatggattttctgctagaaacctggttggattaggaagttttggttctgtgtacaaaggaaatcttgcat 10652543  T
280 cggaaggtaatgttgttgctgtgaaagtcttcaacctccaaaacaatggagctagcaagagtttcattgttgaatgtaatgcact 364  Q
    | |||| ||| ||||||||  | || ||| | ||||| ||||| || ||| ||  |||||| ||| |||||||||||||||||||    
10652542 cagaagataaagttgttgccataaaggtcctgaaccttcaaaaaaagggatctcacaagagcttcgttgttgaatgtaatgcact 10652458  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 179 - 364
Target Start/End: Complemental strand, 10660526 - 10660341
Alignment:
179 agtttcataccaagatttacatcaaggaaccgatggattctcagataaaaacttgattggatcaggaggtttcggttctgtgtacagaggaaatcttgtg 278  Q
    ||||||||| |||||  | || |||||||| |||||||| || | || |||| |  |||||| ||||||||| |||||||| |||| |||||||||||      
10660526 agtttcatatcaagaccttcaccaaggaactgatggattttctgctagaaaccttgttggattaggaggttttggttctgtctacaaaggaaatcttgca 10660427  T
279 tcggaaggtaatgttgttgctgtgaaagtcttcaacctccaaaacaatggagctagcaagagtttcattgttgaatgtaatgcact 364  Q
    || |||| |||  |||||||  | || ||  | ||||| ||||| || ||||||  |||||| |||||||||||||||||||||||    
10660426 tcagaagataaatttgttgccataaaggttctgaaccttcaaaataagggagctcacaagagcttcattgttgaatgtaatgcact 10660341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 335 - 368
Target Start/End: Complemental strand, 10745897 - 10745864
Alignment:
335 caagagtttcattgttgaatgtaatgcactcaaa 368  Q
    ||||||||||||||||||||||||| ||||||||    
10745897 caagagtttcattgttgaatgtaatacactcaaa 10745864  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 142; Significance: 2e-74; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 142; E-Value: 2e-74
Query Start/End: Original strand, 18 - 368
Target Start/End: Complemental strand, 17924005 - 17923655
Alignment:
18 ggtagaaaacatgcaacacaccataatttcaggttggtatcagtgatagttagtgtggtttcttttcttatcatactttcattcattataattatcacct 117  Q
    ||||| |||||||||| ||| || || ||||||||| || |||||||||||||||||||||||||| || ||||||||||||| || || | ||||  |     
17924005 ggtaggaaacatgcaaaacaacacaagttcaggttgatagcagtgatagttagtgtggtttcttttattctcatactttcatttatcatcactatctaca 17923906  T
118 ggatgnnnnnnngaaaccaaaaaccatcttttgattcaccaacaattgatcaactagctaaagtttcataccaagatttacatcaaggaaccgatggatt 217  Q
     ||||       |||| |||||   |||||||||||||||||||||||||||||||||||| |||||||||||||| |||||   |||||||||||||||    
17923905 tgatgaggaagagaaatcaaaagagatcttttgattcaccaacaattgatcaactagctaaggtttcataccaagaattacacgtaggaaccgatggatt 17923806  T
218 ctcagataaaaacttgattggatcaggaggtttcggttctgtgtacagaggaaatcttgtgtcggaaggtaatgttgttgctgtgaaagtcttcaacctc 317  Q
    |||||||| |||| |||| ||||||||| |||| ||||| || |||||||||||| |||| || |||| |||||||||||| || |||||||| ||||||    
17923805 ctcagatagaaacatgatcggatcaggaagttttggttccgtatacagaggaaatattgtttcagaagataatgttgttgcagttaaagtcttgaacctc 17923706  T
318 caaaacaatggagctagcaagagtttcattgttgaatgtaatgcactcaaa 368  Q
    || || || ||||||  |||||||||| ||||||||||||| |||||||||    
17923705 cataaaaagggagctcacaagagtttcgttgttgaatgtaacgcactcaaa 17923655  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 138; Significance: 5e-72; HSPs: 5)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 138; E-Value: 5e-72
Query Start/End: Original strand, 18 - 364
Target Start/End: Original strand, 12948251 - 12948597
Alignment:
18 ggtagaaaacatgcaacacaccataatttcaggttggtatcagtgatagttagtgtggtttcttttcttatcatactttcattcattataattatcacct 117  Q
    ||||| ||||||||||  || || || ||||||||| || ||| |||||||||||||||||||||| || ||||||||||||| || |||| ||||  |     
12948251 ggtaggaaacatgcaaagcaacaaaagttcaggttgatagcagggatagttagtgtggtttcttttattctcatactttcatttatcataactatctaca 12948350  T
118 ggatgnnnnnnngaaaccaaaaaccatcttttgattcaccaacaattgatcaactagctaaagtttcataccaagatttacatcaaggaaccgatggatt 217  Q
     ||||       |||| |||||   ||||||||||||||| |||||||||||||||||||| |||||||||||||| ||||||   |||||| |||||||    
12948351 tgatgaggaaaagaaatcaaaagagatcttttgattcacctacaattgatcaactagctaaggtttcataccaagaattacatgttggaacccatggatt 12948450  T
218 ctcagataaaaacttgattggatcaggaggtttcggttctgtgtacagaggaaatcttgtgtcggaaggtaatgttgttgctgtgaaagtcttcaacctc 317  Q
    |||||||| ||||||||| ||||||||| |||| ||||| || |||||||||||| |||| || |||| |||||||||||| || |||||||| ||||||    
12948451 ctcagatagaaacttgatcggatcaggaagttttggttccgtatacagaggaaatattgtttcagaagataatgttgttgcagtaaaagtcttgaacctc 12948550  T
318 caaaacaatggagctagcaagagtttcattgttgaatgtaatgcact 364  Q
    || || || ||||||  ||||||||||||||||||||||||||||||    
12948551 cagaaaaagggagctcacaagagtttcattgttgaatgtaatgcact 12948597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 18 - 368
Target Start/End: Original strand, 12957685 - 12958035
Alignment:
18 ggtagaaaacatgcaacacaccataatttcaggttggtatcagtgatagttagtgtggtttcttttcttatcatactttcattcattataattatcacct 117  Q
    ||||| ||||||||||  || || || ||||||||| || ||||||||||||||| |||||||||| || ||||||||||||| || |||| ||||  |     
12957685 ggtaggaaacatgcaaagcaacacaagttcaggttgatagcagtgatagttagtgcggtttcttttattctcatactttcatttatcataactatctaca 12957784  T
118 ggatgnnnnnnngaaaccaaaaaccatcttttgattcaccaacaattgatcaactagctaaagtttcataccaagatttacatcaaggaaccgatggatt 217  Q
     ||||       |||| |||||   ||||||||||||||| |||||||||||||||||||| |||||||||||||| ||||||   |||||| |||||||    
12957785 tgatgaggaaaagaaatcaaaagagatcttttgattcacctacaattgatcaactagctaaggtttcataccaagaattacatgttggaaccaatggatt 12957884  T
218 ctcagataaaaacttgattggatcaggaggtttcggttctgtgtacagaggaaatcttgtgtcggaaggtaatgttgttgctgtgaaagtcttcaacctc 317  Q
    |||||||| ||||||||| ||||||||| |||| ||||| || |||||||||||| |||| || |||| ||||||||||||  | |||||||| ||||||    
12957885 ctcagatagaaacttgatcggatcaggaagttttggttccgtatacagaggaaatattgtttcagaagataatgttgttgcaataaaagtcttgaacctc 12957984  T
318 caaaacaatggagctagcaagagtttcattgttgaatgtaatgcactcaaa 368  Q
    || || || ||||||  |||||||||||||||||||||||| |||||||||    
12957985 cagaaaaagggagctcacaagagtttcattgttgaatgtaacgcactcaaa 12958035  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 126; E-Value: 7e-65
Query Start/End: Original strand, 18 - 368
Target Start/End: Original strand, 12931886 - 12932236
Alignment:
18 ggtagaaaacatgcaacacaccataatttcaggttggtatcagtgatagttagtgtggtttcttttcttatcatactttcattcattataattatcacct 117  Q
    ||||| |||||||||| ||| || || ||||||||| || ||||| |||||||||||||||||||| || ||||||||||||| || |||| ||||  |     
12931886 ggtaggaaacatgcaaaacaacacaagttcaggttgatagcagtgctagttagtgtggtttcttttattctcatactttcatttatcataactatctaca 12931985  T
118 ggatgnnnnnnngaaaccaaaaaccatcttttgattcaccaacaattgatcaactagctaaagtttcataccaagatttacatcaaggaaccgatggatt 217  Q
     ||||       |||| || ||   |||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||   ||||||||||||||    
12931986 tgatgaggaaaagaaatcagaagagatcttttgattcaccaacaattgatcaactagctaaggtttcataccaagaattacatgttggaaccgatggatt 12932085  T
218 ctcagataaaaacttgattggatcaggaggtttcggttctgtgtacagaggaaatcttgtgtcggaaggtaatgttgttgctgtgaaagtcttcaacctc 317  Q
    |||| ||| |||| |||| ||||||||| |||| ||||| || |||| ||||||| | ||||| |||| |||||||||||| || || ||||| || ||     
12932086 ctcaaatagaaacatgatcggatcaggaagttttggttccgtttacaaaggaaatatagtgtcagaagataatgttgttgcagtaaaggtcttgaatctg 12932185  T
318 caaaacaatggagctagcaagagtttcattgttgaatgtaatgcactcaaa 368  Q
    ||||| || ||||||  |||||||||||||||||||||||| |||||||||    
12932186 caaaaaaagggagctcacaagagtttcattgttgaatgtaacgcactcaaa 12932236  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 18 - 368
Target Start/End: Original strand, 12906797 - 12907147
Alignment:
18 ggtagaaaacatgcaacacaccataatttcaggttggtatcagtgatagttagtgtggtttcttttcttatcatactttcattcattataattatcacct 117  Q
    ||||| |||||||||| ||| || || ||||||||| || |||| ||||||||||||||||||||| || ||||||||||||| || |||| ||||  |     
12906797 ggtaggaaacatgcaaaacaacacaagttcaggttgatagcagtcatagttagtgtggtttcttttattctcatactttcatttatcataactatctaca 12906896  T
118 ggatgnnnnnnngaaaccaaaaaccatcttttgattcaccaacaattgatcaactagctaaagtttcataccaagatttacatcaaggaaccgatggatt 217  Q
     ||||       |||| |||||   |||||||||||||||||||||||||||||||||||| |||||||||||||| |||||   ||||||||||| |||    
12906897 tgatgaggaaaagaaatcaaaagagatcttttgattcaccaacaattgatcaactagctaaggtttcataccaagaattacacgtaggaaccgatgaatt 12906996  T
218 ctcagataaaaacttgattggatcaggaggtttcggttctgtgtacagaggaaatcttgtgtcggaaggtaatgttgttgctgtgaaagtcttcaacctc 317  Q
    ||| |||| |||| |||| ||||||||| |||| ||||| || |||| ||||||| |||| || |||| |||||||||||| || || ||||| ||||||    
12906997 ctcggatagaaacatgatcggatcaggaagttttggttccgtatacaaaggaaatattgtttcagaagataatgttgttgcagtaaaggtcttgaacctc 12907096  T
318 caaaacaatggagctagcaagagtttcattgttgaatgtaatgcactcaaa 368  Q
    ||||  || || |||  ||| |||||||||||||||||||| |||||||||    
12907097 caaacaaagggcgctcacaaaagtttcattgttgaatgtaacgcactcaaa 12907147  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 118; E-Value: 4e-60
Query Start/End: Original strand, 18 - 368
Target Start/End: Original strand, 12899177 - 12899527
Alignment:
18 ggtagaaaacatgcaacacaccataatttcaggttggtatcagtgatagttagtgtggtttcttttcttatcatactttcattcattataattatcacct 117  Q
    ||||| ||||||| || ||| || || ||||||||| || |||||||||||||||||||||||||| || ||||||||||||| || |||| ||||  |     
12899177 ggtaggaaacatgtaaaacaacacaagttcaggttgatagcagtgatagttagtgtggtttcttttattctcatactttcatttatcataactatctaca 12899276  T
118 ggatgnnnnnnngaaaccaaaaaccatcttttgattcaccaacaattgatcaactagctaaagtttcataccaagatttacatcaaggaaccgatggatt 217  Q
     ||||        ||| |||||   |||||||||||||||| ||||||||||||||||||| ||||| |||||||| |||||   |||||||||||||||    
12899277 tgatgagtaaaataaatcaaaagagatcttttgattcaccagcaattgatcaactagctaaggtttcgtaccaagaattacacgtaggaaccgatggatt 12899376  T
218 ctcagataaaaacttgattggatcaggaggtttcggttctgtgtacagaggaaatcttgtgtcggaaggtaatgttgttgctgtgaaagtcttcaacctc 317  Q
    |||||||| ||||||||| ||||||||| |||| ||||| || |||||||||||| | || || |||| |||||||||||| || || ||||| || ||     
12899377 ctcagatagaaacttgatcggatcaggaagttttggttccgtatacagaggaaatatagtttcagaagataatgttgttgcagtaaaggtcttgaatctg 12899476  T
318 caaaacaatggagctagcaagagtttcattgttgaatgtaatgcactcaaa 368  Q
    ||||| || || |||  ||||||||||||| | ||||||||||||||||||    
12899477 caaaaaaagggtgctcacaagagtttcattttagaatgtaatgcactcaaa 12899527  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 43 - 95
Target Start/End: Complemental strand, 31467739 - 31467687
Alignment:
43 atttcaggttggtatcagtgatagttagtgtggtttcttttcttatcatactt 95  Q
    |||||| |||| || ||||||||||||||||||||||||||||| | ||||||    
31467739 atttcaagttgatagcagtgatagttagtgtggtttcttttcttcttatactt 31467687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 136786 times since January 2019
Visitors: 1443