View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1613_low_12 (Length: 339)

Name: NF1613_low_12
Description: NF1613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1613_low_12
NF1613_low_12
[»] chr2 (6 HSPs)
chr2 (16-329)||(35280012-35280325)
chr2 (16-329)||(35289357-35289670)
chr2 (16-313)||(35275245-35275542)
chr2 (21-329)||(35322164-35322469)
chr2 (107-329)||(35307246-35307468)
chr2 (107-329)||(35311589-35311814)


Alignment Details
Target: chr2 (Bit Score: 278; Significance: 1e-155; HSPs: 6)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 16 - 329
Target Start/End: Original strand, 35280012 - 35280325
Alignment:
16 tcatcttcaccatagcaaaagcaaagtctcttctaaaagcaaaaccatttatactataagccctaaccaaagaaactggagaaccaacaccattgaaaag 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35280012 tcatcttcaccatagcaaaagcaaagtctcttctaaaagcaaaaccatttatactataagccctaaccaaagaaactggagaaccaacaccattgaaaag 35280111  T
116 tgcttgatcagaatgaagaagtcctttattagcaacaaggtccctatagtaattattgtcaaaagtaactggagagacagaatcaagaggtgccaaattt 215  Q
    |||||||||||||| ||||||||||||||||||||| || |||||||| ||||| |||||||||||||| |||||||||||||||||||| |||||||||    
35280112 tgcttgatcagaattaagaagtcctttattagcaactagatccctataataattgttgtcaaaagtaacaggagagacagaatcaagaggagccaaattt 35280211  T
216 gtgtcaccaccagaaagaggacagtttgcttttcttaaggttgcaaagtttgtgtcgatgtttgtttcattgtatatgcgatttcggaaaaattgacatt 315  Q
    |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
35280212 gtgtcaccgccagaaagaggacagtttgcttttcttaaggttgcaaagtttgtgtcgatgttggtttcattgtatatgcgatttcggaaaaattgacatt 35280311  T
316 ctgcttggcctatg 329  Q
    ||||||||||||||    
35280312 ctgcttggcctatg 35280325  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 16 - 329
Target Start/End: Original strand, 35289357 - 35289670
Alignment:
16 tcatcttcaccatagcaaaagcaaagtctcttctaaaagcaaaaccatttatactataagccctaaccaaagaaactggagaaccaacaccattgaaaag 115  Q
    |||||||||||||||||   |||||||||||| ||||||||| |  |||| ||||||||| |||||||||||||||| ||||||||||||||||||||||    
35289357 tcatcttcaccatagcagctgcaaagtctcttttaaaagcaatattatttctactataagtcctaaccaaagaaacttgagaaccaacaccattgaaaag 35289456  T
116 tgcttgatcagaatgaagaagtcctttattagcaacaaggtccctatagtaattattgtcaaaagtaactggagagacagaatcaagaggtgccaaattt 215  Q
     |||||||||||||||||||||||||||||||||||||||||  |||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
35289457 agcttgatcagaatgaagaagtcctttattagcaacaaggtcattatagtaattgttgtcaaaagtaactggagagacagaatcaagaggtgccaaattt 35289556  T
216 gtgtcaccaccagaaagaggacagtttgcttttcttaaggttgcaaagtttgtgtcgatgtttgtttcattgtatatgcgatttcggaaaaattgacatt 315  Q
     ||||||||||||||  |||||| |||| ||||||||||||||||||||||||||| ||||| ||||| |||||||| ||| ||| ||||||||||||||    
35289557 atgtcaccaccagaagtaggacaatttgattttcttaaggttgcaaagtttgtgtcaatgttggtttcgttgtatatacgagttctgaaaaattgacatt 35289656  T
316 ctgcttggcctatg 329  Q
    ||||||| ||||||    
35289657 ctgcttgacctatg 35289670  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 16 - 313
Target Start/End: Original strand, 35275245 - 35275542
Alignment:
16 tcatcttcaccatagcaaaagcaaagtctcttctaaaagcaaaaccatttatactataagccctaaccaaagaaactggagaaccaacaccattgaaaag 115  Q
    |||||||||||||||||  ||||||||||||   |||||||  ||||| | |||||||   |||||||||||||| | |||||||| |||||||||||||    
35275245 tcatcttcaccatagcagcagcaaagtctctagaaaaagcagcaccatctctactatacttcctaaccaaagaaatttgagaaccaccaccattgaaaag 35275344  T
116 tgcttgatcagaatgaagaagtcctttattagcaacaaggtccctatagtaattattgtcaaaagtaactggagagacagaatcaagaggtgccaaattt 215  Q
      ||||||||||||| ||||| ||||||||||||| ||||||| |||| ||||| ||||||||  ||  ||||| |||||||||||  ||||| |||||     
35275345 aacttgatcagaatgtagaagacctttattagcaataaggtccttataataattgttgtcaaatttagttggagtgacagaatcaaagggtgctaaattg 35275444  T
216 gtgtcaccaccagaaagaggacagtttgcttttcttaaggttgcaaagtttgtgtcgatgtttgtttcattgtatatgcgatttcggaaaaattgaca 313  Q
    ||||||||||||||   ||| || |||  |||||||||||| || |||||| |||| ||||| | |||||||| ||||||||||| ||||||||||||    
35275445 gtgtcaccaccagaggtagggcaatttctttttcttaaggtagccaagtttctgtcaatgttggcttcattgtgtatgcgatttctgaaaaattgaca 35275542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 21 - 329
Target Start/End: Original strand, 35322164 - 35322469
Alignment:
21 ttcaccatagcaaaagcaaagtctcttctaaaagcaaaaccatttatactataagccctaaccaaagaaactggagaaccaacaccattgaaaagtgctt 120  Q
    ||||||||||||| |||||||||||||||||||| |  ||||||  ||||||||  ||||||||||  | || |||| |||  |   |||||||| ||||    
35322164 ttcaccatagcaacagcaaagtctcttctaaaagtagcaccattggtactataactcctaaccaaattatcttgagacccatta---ttgaaaagagctt 35322260  T
121 gatcagaatgaagaagtcctttattagcaacaaggtccctatagtaattattgtcaaaagtaactggagagacagaatcaagaggtgccaaatttgtgtc 220  Q
    |||||||||| | ||| |||||  | |||||||| |   |||||||||| ||||||||| |   ||||| || ||  ||||||||||| ||||| |||||    
35322261 gatcagaatggaaaagacctttgcttgcaacaagatttttatagtaattgttgtcaaaatttgttggagtgagagtgtcaagaggtgctaaattggtgtc 35322360  T
221 accaccagaaagaggacagtttgcttttcttaaggttgcaaagtttgtgtcgatgtttgtttcattgtatatgcgatttcggaaaaattgacattctgct 320  Q
    |||||||||||||||||| |||  ||| ||||||||||||||||||||||| ||||| |||||||||||||||||||||| ||||||||| || ||| ||    
35322361 accaccagaaagaggacaatttaatttccttaaggttgcaaagtttgtgtcaatgttggtttcattgtatatgcgatttctgaaaaattggcactctcct 35322460  T
321 tggcctatg 329  Q
    |||||||||    
35322461 tggcctatg 35322469  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 99; E-Value: 8e-49
Query Start/End: Original strand, 107 - 329
Target Start/End: Original strand, 35307246 - 35307468
Alignment:
107 attgaaaagtgcttgatcagaatgaagaagtcctttattagcaacaaggtccctatagtaattattgtcaaaagtaactggagagacagaatcaagaggt 206  Q
    ||||||||| |||||||||||||| | ||| |||||  | ||||||||||   |||||||||| || |||||| |   ||||| || || |||||| |||    
35307246 attgaaaagagcttgatcagaatggaaaagacctttgcttgcaacaaggtttttatagtaattgttatcaaaacttgttggagtgagagtatcaagtggt 35307345  T
207 gccaaatttgtgtcaccaccagaaagaggacagtttgcttttcttaaggttgcaaagtttgtgtcgatgtttgtttcattgtatatgcgatttcggaaaa 306  Q
    || ||||| ||||||||||||||||||||||| |||| ||| ||||||||||||||||||||||| ||||| |||||||||||||||||||||| |||||    
35307346 gctaaattggtgtcaccaccagaaagaggacaatttgatttccttaaggttgcaaagtttgtgtcaatgttggtttcattgtatatgcgatttctgaaaa 35307445  T
307 attgacattctgcttggcctatg 329  Q
    |||| || ||| |||||||||||    
35307446 attggcactctccttggcctatg 35307468  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 107 - 329
Target Start/End: Original strand, 35311589 - 35311814
Alignment:
107 attgaaaagtgcttgatcagaatgaagaagtcctttattagcaacaaggtccctatagtaattattgtcaaaagtaactggagagacagaatcaagaggt 206  Q
    |||||||||  ||||||||||||| |  || |||||  | ||||||||||   |||| ||||| ||||||||| |   ||||| || || |||||| |||    
35311589 attgaaaaggacttgatcagaatggaatagacctttgcttgcaacaaggtttttataataattgttgtcaaaacttgttggagtgagagtatcaagtggt 35311688  T
207 gccaaatttgtgtcac---caccagaaagaggacagtttgcttttcttaaggttgcaaagtttgtgtcgatgtttgtttcattgtatatgcgatttcgga 303  Q
    || ||||| ||||||    ||| ||||| || |||||| | ||||||||||||||| ||||||||||| ||||| |||||||||||||||||| ||| ||    
35311689 gctaaattggtgtcattgtcactagaaaaagaacagttggattttcttaaggttgcgaagtttgtgtcaatgttggtttcattgtatatgcgagttctga 35311788  T
304 aaaattgacattctgcttggcctatg 329  Q
    | ||| |||| ||| |||||||||||    
35311789 acaatcgacactctccttggcctatg 35311814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 137385 times since January 2019
Visitors: 1447