View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1613_low_13 (Length: 338)

Name: NF1613_low_13
Description: NF1613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF1613_low_13
[»] chr4 (1 HSPs)
chr4 (8-321)||(13205915-13206227)

Alignment Details
Target: chr4 (Bit Score: 290; Significance: 1e-163; HSPs: 1)
Name: chr4

Target: chr4; HSP #1
Raw Score: 290; E-Value: 1e-163
Query Start/End: Original strand, 8 - 321
Target Start/End: Complemental strand, 13206227 - 13205915
8 gagaagaagtaaattcgacggttgatttctttttctacaaagtaaattgttataaccattttgatcaagatgttatttggatattctcaagtttttccta 107  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13206227 gagaagaagtaaattcgacagttgatttctttttctacaaagtaaattgttataaccattttgatcaagatgttatttggatattctcaagtttttccta 13206128  T
108 agctaaatctactctactatgtgtgttgccaaaaacatcttgttccaagatttttagaaaaggctttaagatcttgagctttttgtgaaacttatgcata 207  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||    
13206127 agctaaatctactctactatgtgtgttgccaaaaacatcttgttccaagatttt-agaaaaggctttaagatcttgagctttttgtgaagcttatgcata 13206029  T
208 agagaaatagaaattgagatgtttcaactagaagctatcaaatcctcacaattgggattggtgttcgaagttataaagaacttaaatcttgagacaatat 307  Q
    ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
13206028 agagaaatagaaattgagatgttccaactagaagctatcaaatcctcacaattgggattggtgttccaagttataaagaacttaaatcttgagacaatat 13205929  T
308 taataggactatat 321  Q
13205928 taataggactatat 13205915  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 137292 times since January 2019
Visitors: 1446