View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1613_low_14 (Length: 316)

Name: NF1613_low_14
Description: NF1613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1613_low_14
NF1613_low_14
[»] chr2 (1 HSPs)
chr2 (1-316)||(8188098-8188413)


Alignment Details
Target: chr2 (Bit Score: 304; Significance: 1e-171; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 304; E-Value: 1e-171
Query Start/End: Original strand, 1 - 316
Target Start/End: Original strand, 8188098 - 8188413
Alignment:
1 gagaagaggaatgacttgattagtggtactagtgatggttttaggatagaagacataagcaacacaacgaaaccccgaagcccagtgatagacatagata 100  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8188098 gagaagaagaatgacttgattagtggtactagtgatggttttaggatagaagacataagcaacacaacgaaaccccgaagcccagtgatagacatagata 8188197  T
101 ctgaggatgctatttgtatgcgtactagagctcgttattcgcttgaaggtttcagtcttgatgagcttgagacctttcttcaagagaccgatgatgaaga 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
8188198 ctgaggatgctatttgtatgcgtactagagctcgttattcgcttgaaggtttcagtcttgatgagcttgagacctttcttcaagagactgatgatgaaga 8188297  T
201 tgatgttcaaaatgtcgatgatgaagaagagtataaaaaatttctagcagctgtattacagggtggagaacgtgacggtctttcatctcatgaaaatgaa 300  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8188298 tgatgttcaaaatgtcgatgatgaagaagagtataaaaaatttctagcagctgtattacagggtggagaacgtgacggtctttcatctcatgaaaatgaa 8188397  T
301 aaccttgatggtgatg 316  Q
    |||||||||| |||||    
8188398 aaccttgatgatgatg 8188413  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 137199 times since January 2019
Visitors: 1446