View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1613_low_15 (Length: 263)

Name: NF1613_low_15
Description: NF1613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1613_low_15
NF1613_low_15
[»] chr3 (2 HSPs)
chr3 (1-210)||(26017781-26017990)
chr3 (4-210)||(26003035-26003241)
[»] chr5 (1 HSPs)
chr5 (26-202)||(30374295-30374471)


Alignment Details
Target: chr3 (Bit Score: 178; Significance: 4e-96; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 210
Target Start/End: Complemental strand, 26017990 - 26017781
Alignment:
1 attgcaattaattgatgaagtcctataccttttcccataatccatctgaagctaagattaacaagtcatggtgaggttcaattctgagtactttggtctc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||    
26017990 attgcaattaattgatgaagtcctataccttttcccataatccatctgaagctaagattaaaaagtcatgatgaggttcaattctgagtactttggtctc 26017891  T
101 aggctctgctatcacccattgtttcatgtgtccatcaccaatgctccttgaaacagcaagagatccttggattctccaaacaccgcggcacatatcaaca 200  Q
    ||| |||||||||||  ||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||    
26017890 aggttctgctatcacatattgtttcatgtgtctatctccaatgctccttgaaacagcaagagatccttggattctccaaacaccgcggcacatatctaca 26017791  T
201 tatcctccct 210  Q
    ||||||||||    
26017790 tatcctccct 26017781  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 4 - 210
Target Start/End: Complemental strand, 26003241 - 26003035
Alignment:
4 gcaattaattgatgaagtcctataccttttcccataatccatctgaagctaagattaacaagtcatggtgaggttcaattctgagtactttggtctcagg 103  Q
    ||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
26003241 gcaattaattggtcaagtcctataccttttcccataatccatctgaagctaagattaacaagtcatgatgaggttcaattctgagtactttggtctcagg 26003142  T
104 ctctgctatcacccattgtttcatgtgtccatcaccaatgctccttgaaacagcaagagatccttggattctccaaacaccgcggcacatatcaacatat 203  Q
     |||||||||||  ||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
26003141 ttctgctatcacatattgtttcatgtgtctatctccaatgctccttgaaacagcaagagatccttggattctccaaacaccgcggcacatatcgacatat 26003042  T
204 cctccct 210  Q
    |||||||    
26003041 cctccct 26003035  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 26 - 202
Target Start/End: Complemental strand, 30374471 - 30374295
Alignment:
26 taccttttcccataatccatctgaagctaagattaacaagtcatggtgaggttcaattctgagtactttggtctcaggctctgctatcacccattgtttc 125  Q
    |||||| ||||||||||||||||||||||| |||||||||||||| | |||||||||||| |  ||||| ||||| ||||| ||| ||||||||||||||    
30374471 taccttatcccataatccatctgaagctaatattaacaagtcatgttcaggttcaattctaataactttagtctcgggctccgctgtcacccattgtttc 30374372  T
126 atgtgtccatcaccaatgctccttgaaacagcaagagatccttggattctccaaacaccgcggcacatatcaacata 202  Q
    | |||||  || ||||| |  ||||| ||||||||||||||||| || |||||||||||||| || | |||||||||    
30374371 aagtgtcggtctccaattcctcttgatacagcaagagatccttgaatcctccaaacaccgcgacataaatcaacata 30374295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 137123 times since January 2019
Visitors: 1444