View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1613_low_16 (Length: 246)

Name: NF1613_low_16
Description: NF1613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1613_low_16
NF1613_low_16
[»] chr4 (1 HSPs)
chr4 (4-232)||(40063637-40063866)


Alignment Details
Target: chr4 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 4 - 232
Target Start/End: Complemental strand, 40063866 - 40063637
Alignment:
4 aataattgttttaagagaacaaaaatcataatccaatacatgtccttattattaa-taaataataatgtcaactataaaattcttttcattttatgtata 102  Q
    ||||||| |||||||| ||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||  ||||||    
40063866 aataatttttttaagataacaaaaatcataatccaatagatgtccttattattaaataaataataatgtcaactataaaattcttttcatttattgtata 40063767  T
103 tttggagtgatattttgcctctattttgacattcatataactaatgacacatcatcaaagcaaagttagtaccaattccaaccccagcctgcagatgagt 202  Q
    ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40063766 ttttgagtgatattttgcctctattttgacattcatataactaatgacacatcatcaaagcaaagttagtaccaattccaaccccagcctgcagatgagt 40063667  T
203 gagttttgccaaactagcacgcctcaatat 232  Q
    ||||||||||||||||||||||||||||||    
40063666 gagttttgccaaactagcacgcctcaatat 40063637  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 137011 times since January 2019
Visitors: 1444