View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1613_low_17 (Length: 245)

Name: NF1613_low_17
Description: NF1613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF1613_low_17
[»] chr6 (1 HSPs)
chr6 (4-239)||(14408502-14408737)
[»] scaffold1515 (1 HSPs)
scaffold1515 (38-239)||(1-202)
[»] scaffold1889 (1 HSPs)
scaffold1889 (4-172)||(845-1013)

Alignment Details
Target: chr6 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr6

Target: chr6; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 4 - 239
Target Start/End: Original strand, 14408502 - 14408737
4 cacgagcgttggagtagttaacatagccatatccaagagatgactgcgtcatctgatctctgcaaaccctaacagaaatcacaggggcaatctggctgaa 103  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14408502 cacgagcgttggagtagttaacatagccataaccaagagatgactgcgtcatctgatctctgcaaaccctaacagaaatcacaggggcaatctggctgaa 14408601  T
104 cagatcatacagctgcgcatcatttacgttcccttgaagatcaccgacgtacaaagaagaattctcaaatcttccagcactggtcaaagctgctggaaca 203  Q
14408602 cagatcatacagctgcgcatcatttacgttcccttgaagatcaccgacgtacaaagaagaattctcaaatcttccagcactggtcaaagctgctggaaca 14408701  T
204 acgatcgttggagatgaaattattgctgcctttgct 239  Q
    |||||| |||| ||||||| |||||||||| |||||    
14408702 acgatctttggtgatgaaactattgctgccattgct 14408737  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1515 (Bit Score: 86; Significance: 3e-41; HSPs: 1)
Name: scaffold1515

Target: scaffold1515; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 38 - 239
Target Start/End: Original strand, 1 - 202
38 aagagatgactgcgtcatctgatctctgcaaaccctaacagaaatcacaggggcaatctggctgaacagatcatacagctgcgcatcatttacgttccct 137  Q
    |||||||||||||||||||||||| | |||||||||| |||||| ||| || |||||||| |||||||||||||| |||||  | ||||| ||||||| |    
1 aagagatgactgcgtcatctgatcccggcaaaccctagcagaaagcactggtgcaatctgactgaacagatcataaagctggccctcattgacgttcctt 100  T
138 tgaagatcaccgacgtacaaagaagaattctcaaatcttccagcactggtcaaagctgctggaacaacgatcgttggagatgaaattattgctgcctttg 237  Q
    |  |||||||| ||||| || ||||   ||||||||||||||| || ||||||||||||||||||||||||| |||| |||||||  | ||||||| |||    
101 tcgagatcaccaacgtataaggaagcggtctcaaatcttccagtaccggtcaaagctgctggaacaacgatctttggtgatgaaaccactgctgccattg 200  T
238 ct 239  Q
201 ct 202  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1889 (Bit Score: 57; Significance: 6e-24; HSPs: 1)
Name: scaffold1889

Target: scaffold1889; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 4 - 172
Target Start/End: Complemental strand, 1013 - 845
4 cacgagcgttggagtagttaacatagccatatccaagagatgactgcgtcatctgatctctgcaaaccctaacagaaatcacaggggcaatctggctgaa 103  Q
    |||||||||||||| |||| ||||||||||| |||||||||||||||||||||||||| || |||||||| || ||||| ||  || |||||||   ||     
1013 cacgagcgttggagaagttgacatagccataaccaagagatgactgcgtcatctgatccctacaaaccctgacggaaataacgtggccaatctgatagag 914  T
104 cagatcatacagctgcgcatcatttacgttcccttgaagatcaccgacgtacaaagaagaattctcaaa 172  Q
      | ||||| ||||| || ||||| || |||| || ||||||||| |||||||| |||| |||||||||    
913 aggttcataaagctgggcctcattcaccttcctttcaagatcaccaacgtacaatgaagcattctcaaa 845  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 136914 times since January 2019
Visitors: 1443