View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1613_low_18 (Length: 238)

Name: NF1613_low_18
Description: NF1613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1613_low_18
NF1613_low_18
[»] chr7 (1 HSPs)
chr7 (23-238)||(5517208-5517426)


Alignment Details
Target: chr7 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 23 - 238
Target Start/End: Original strand, 5517208 - 5517426
Alignment:
23 aatagctagcaaaaaactagagtttttatagaaaagttcaaagttcaaaacctagctaaagctagcctggcattattccaattggtatgttaaatacttg 122  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
5517208 aataactagcaaaaaactagagtttttatagaaaagttcaaagttcaaaacctagctaaagctagcctggcattattccaattggtatgttaaatactta 5517307  T
123 ggacaactcaaattaaaac---tgaatatactaaattacaatcaagtgactaaagaaaaaacaatgccagggaactggttggtatggactacaatgattg 219  Q
    ||||| |||||||||||||   ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
5517308 ggacagctcaaattaaaacacatgaatatactaaattacaatcaagtgactaaagaaaaaacaatgccagggaaccggttggtatggactacaatgattg 5517407  T
220 aacgtggccatcctgttgc 238  Q
    ||||||||||| |||||||    
5517408 aacgtggccattctgttgc 5517426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 136808 times since January 2019
Visitors: 1443