View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1613_low_19 (Length: 237)

Name: NF1613_low_19
Description: NF1613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1613_low_19
NF1613_low_19
[»] chr5 (1 HSPs)
chr5 (1-219)||(7077451-7077671)


Alignment Details
Target: chr5 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 7077451 - 7077671
Alignment:
1 cctactgatgtaaaggcataactaaaattaattgttagtaaatatagcggaaacccaaaccttcagatgttaagcaaccaaaaccttacagttttgcttt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
7077451 cctactgatgtaaaggcataactaaaattaattgttagtaaatatagcggaaacccaaaccttcagatgttaagcaaccaaaaccttgcagttttgcttt 7077550  T
101 aaaattaagcttcgtggctctc--ctacatcaccaaaccatagtctcgtctagtttccctcgttattggttgaaaaggtttaaacccatttaataatttg 198  Q
    ||||||||||||||||||||||  ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
7077551 aaaattaagcttcgtggctctcctctacatcaccaaaccttagtctcgtctagtttccctcgttattggttgaaaaggtttaaactcatttaataatttg 7077650  T
199 aatatccttaaattagtgaat 219  Q
    ||||| ||| ||| |||||||    
7077651 aatatactttaatgagtgaat 7077671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 137485 times since January 2019
Visitors: 1448