View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1613_low_2 (Length: 469)

Name: NF1613_low_2
Description: NF1613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1613_low_2
NF1613_low_2
[»] chr1 (1 HSPs)
chr1 (20-460)||(8840160-8840617)


Alignment Details
Target: chr1 (Bit Score: 346; Significance: 0; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 346; E-Value: 0
Query Start/End: Original strand, 20 - 460
Target Start/End: Complemental strand, 8840617 - 8840160
Alignment:
20 tctacctcaccctagtgtctgccattgcagcatacataggacagaaaatcattgacaagcttgtcaatatctttcaaagagcttccttgattatctttgt 119  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8840617 tctacctcaccctagtgtctaccattgcagcatacataggacagaaaatcattgacaagcttgtcaatatctttcaaagagcttccttgattatctttgt 8840518  T
120 tttatccttcacaattcttgttagtgcaattgcactaggtgagtaatgcttatatatgttataatgagtcaaattgccatgcttgttttaactatatcaa 219  Q
    |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||| ||| ||||||||||||||    
8840517 tttatccttcacaattcttgttagtgcaattgcactaggtaagtaatgcttatatatgttataatgagtcaaattgtcatgtttgatttaactatatcaa 8840418  T
220 -----------------atattttaaattgtgtatgtcaaatattcttgacattgcgaaaaattgcaatgtggttgcggacgcctccaaaacttgtatag 302  Q
                     ||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||    
8840417 gagaatgttatggtcaaatattttaaattgtgcatgtcaaatattcttgacatcgcgaaaaattgcaatgtggttgcggacgcctccaaaacatgtatag 8840318  T
303 aatttgtttctagacacatgcatgcaattgatgtgactaaaattgtggttgcgatgtgattgcagagacctctaaaaacgtcataataatcgcattgcag 402  Q
    ||||||||||||||||||||||||| |||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |    
8840317 aatttgtttctagacacatgcatgctattgatatgactaaaattgtggttgcaatgtgattgcagagacctctaaaaacgtcataataatcgcattgcgg 8840218  T
403 agaaaaatatgacgattgctaattaatttttacattttaagctttcatttccctatgc 460  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||    
8840217 agaaaaatatgacgattgctaattagtttttacattttaagctttcatttcactatgc 8840160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 137376 times since January 2019
Visitors: 1447