View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1613_low_20 (Length: 236)
Name: NF1613_low_20
Description: NF1613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1613_low_20 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 176; Significance: 6e-95; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 12 - 220
Target Start/End: Original strand, 31108141 - 31108349
Alignment:
Q |
12 |
atgagatatttaccagttacaaaaacatcaaagtaaagcnnnnnnnttctcaagggacaacttaatattaagataaaccaaaattaaaactcaacaagca |
111 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||| |||||||||||||||||||| |
|
|
T |
31108141 |
atgagatatttaccagttacaaaaacatcaaagtaaagcaaaaaaattctcaagggacaacttaatatgaagataaaccgaaattaaaactcaacaagca |
31108240 |
T |
 |
Q |
112 |
tcaaaaagtatatataagcatagaaaagaaaattgctgatgctataccctattcttcctttcttcttcaccttcctcagttgatactctcatccatcttt |
211 |
Q |
|
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
31108241 |
tcaaaaagtatatataagcatagaaaataaaattgctgatgctataccctattcttcctttcttcttcaccttcctcagttgatactctcatccatcttt |
31108340 |
T |
 |
Q |
212 |
gtttgtcac |
220 |
Q |
|
|
||||||||| |
|
|
T |
31108341 |
gtttgtcac |
31108349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 131 - 168
Target Start/End: Original strand, 31105078 - 31105115
Alignment:
Q |
131 |
atagaaaagaaaattgctgatgctataccctattcttc |
168 |
Q |
|
|
||||||||||||| ||||||||||||| |||||||||| |
|
|
T |
31105078 |
atagaaaagaaaactgctgatgctatatcctattcttc |
31105115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Noble Research Institute, LLC
This website was viewed 136915 times since January 2019
Visitors: 1443