View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1613_low_20 (Length: 236)

Name: NF1613_low_20
Description: NF1613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1613_low_20
NF1613_low_20
[»] chr4 (2 HSPs)
chr4 (12-220)||(31108141-31108349)
chr4 (131-168)||(31105078-31105115)


Alignment Details
Target: chr4 (Bit Score: 176; Significance: 6e-95; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 12 - 220
Target Start/End: Original strand, 31108141 - 31108349
Alignment:
12 atgagatatttaccagttacaaaaacatcaaagtaaagcnnnnnnnttctcaagggacaacttaatattaagataaaccaaaattaaaactcaacaagca 111  Q
    |||||||||||||||||||||||||||||||||||||||       |||||||||||||||||||||| |||||||||| ||||||||||||||||||||    
31108141 atgagatatttaccagttacaaaaacatcaaagtaaagcaaaaaaattctcaagggacaacttaatatgaagataaaccgaaattaaaactcaacaagca 31108240  T
112 tcaaaaagtatatataagcatagaaaagaaaattgctgatgctataccctattcttcctttcttcttcaccttcctcagttgatactctcatccatcttt 211  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31108241 tcaaaaagtatatataagcatagaaaataaaattgctgatgctataccctattcttcctttcttcttcaccttcctcagttgatactctcatccatcttt 31108340  T
212 gtttgtcac 220  Q
    |||||||||    
31108341 gtttgtcac 31108349  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 131 - 168
Target Start/End: Original strand, 31105078 - 31105115
Alignment:
131 atagaaaagaaaattgctgatgctataccctattcttc 168  Q
    ||||||||||||| ||||||||||||| ||||||||||    
31105078 atagaaaagaaaactgctgatgctatatcctattcttc 31105115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 136915 times since January 2019
Visitors: 1443