View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1613_low_21 (Length: 230)

Name: NF1613_low_21
Description: NF1613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1613_low_21
NF1613_low_21
[»] chr5 (1 HSPs)
chr5 (26-216)||(4274439-4274629)


Alignment Details
Target: chr5 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 26 - 216
Target Start/End: Complemental strand, 4274629 - 4274439
Alignment:
26 ttttgatattgtggcaatccattactatccttaatgttacgattgtcatttcaaagatctttaaatttaccgacgaatgttggttcaagtggcaagaaag 125  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4274629 ttttgatattgtggcaatccattactatccttaatgttacgattgtcatttcaaagatctttaaatttaccgacgaatgttggttcaagtggcaagaaag 4274530  T
126 tttggtgctcctaagtacgatatgaggttgagtcttgtaaatggaaaaatttatgttattccctttattcttatctactgactcagttcat 216  Q
    ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4274529 tttggtgctcctaagtacgatatgaggttgaatcttgtaaatggaaaaatttatgttattccctttattcttatctactgactcagttcat 4274439  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 136829 times since January 2019
Visitors: 1443