View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1613_low_3 (Length: 467)

Name: NF1613_low_3
Description: NF1613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1613_low_3
NF1613_low_3
[»] chr1 (1 HSPs)
chr1 (20-467)||(36635217-36635664)


Alignment Details
Target: chr1 (Bit Score: 395; Significance: 0; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 395; E-Value: 0
Query Start/End: Original strand, 20 - 467
Target Start/End: Original strand, 36635217 - 36635664
Alignment:
20 actccaacactgatttgtcataaaagatgtctttccttctctagatcaagttctaatccagtctatttgttgtcatagtaattttattcttcacatatat 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36635217 actccaacactgatttgtcataaaagatgtctttccttctctagatcaagttctaatccagtctatttgttgtcatagtaattttattcttcacatatat 36635316  T
120 gccggcgtgcaaccaacagatgattcttatagtaaacttgaatgacattgaagctcttataaacaaatgtgatttaagactggaaaattttattcttcat 219  Q
    |||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36635317 gccggcgtgcaaccaatagatgattgttatagtaaacttgaatgacattgaagctcttataaacaaatgtgatttaagactggaaaattttattcttcat 36635416  T
220 ttatgatttcaatgctagattatacgtcaaattgattgttttgaattcatggtttacattttttattttgaaatcatagtttacaagagttgtttagttt 319  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36635417 ttatgatttcaatgctagattatacgtcaaattgattgttttgaattcatggtttacattttttattttgaaatcatagtttacaagagttgtttagttt 36635516  T
320 catggtttgattagttaacacatgaaattattataaaaataaagaaggtcaaaattgacttgcattaacatcaaggagatacaatcatttcagagctaga 419  Q
    |||| |||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36635517 catgatttgattagttaacacataaaattattataaacataaagaaggtcaaaattgacttgcattaacatcaaggagatacaatcatttcagagctaga 36635616  T
420 acatagaaagcctaatcacgctnnnnnnnctacaaagaaataaagctt 467  Q
    | |||||||||||||||| |||        ||||||||||||||||||    
36635617 aaatagaaagcctaatcaagctaaaaaaattacaaagaaataaagctt 36635664  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 137494 times since January 2019
Visitors: 1448