View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1613_low_7 (Length: 396)

Name: NF1613_low_7
Description: NF1613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1613_low_7
NF1613_low_7
[»] chr1 (2 HSPs)
chr1 (18-383)||(40425429-40425794)
chr1 (100-164)||(8807595-8807659)
[»] chr8 (2 HSPs)
chr8 (296-356)||(5057475-5057535)
chr8 (119-184)||(32408434-32408499)
[»] chr2 (2 HSPs)
chr2 (18-70)||(7633541-7633592)
chr2 (84-148)||(43260444-43260508)
[»] chr3 (2 HSPs)
chr3 (89-168)||(54485558-54485637)
chr3 (18-67)||(31261054-31261103)
[»] chr7 (2 HSPs)
chr7 (132-192)||(5335916-5335976)
chr7 (84-192)||(46989899-46990007)


Alignment Details
Target: chr1 (Bit Score: 350; Significance: 0; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 350; E-Value: 0
Query Start/End: Original strand, 18 - 383
Target Start/End: Complemental strand, 40425794 - 40425429
Alignment:
18 tttcttgatagtttctcctatagtgtatcttggtcttcctttgcctctagcaactgagctacgctacatctgatctactctccttactttggaatataca 117  Q
    |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
40425794 tttcttgatagtttctcctatagtgtttcttggtcttcctttgcctctagcaactgagctacactacatctgatctactctccttactttggaatataca 40425695  T
118 agtctccttcacacatgcccaaaccccctaaatctagattcaaccatctttcctataaaagatgctatcccaactacctctctaatataataattcctaa 217  Q
     |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40425694 ggtctccttcacacatgcccaaaccccctaaatctagatccaaccatctttcctataaaagatgctatcccaactacctctctaatataataattcctaa 40425595  T
218 gcatactctatctagtatcccacacatctagcatagcattctcatcttttctacactaactttactccggtgttgacattttaccacccaccactccatc 317  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40425594 gcatactctatctagtatcccacacatctagcatagcattctcatcttttctacactaactttactccggtgttgacattttaccacccaccactccatc 40425495  T
318 acgtacaacattgttggtcttatagttgtacggtaaaacttcccctttaccttgagcggtaccttc 383  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40425494 acgtacaacattgttggtcttatagttgtacggtaaaacttcccctttaccttgagcggtaccttc 40425429  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 100 - 164
Target Start/End: Complemental strand, 8807659 - 8807595
Alignment:
100 cttactttggaatatacaagtctccttcacacatgcccaaaccccctaaatctagattcaaccat 164  Q
    |||||| |||||| ||||||| | || |||||||||||||| | ||||| || ||||||||||||    
8807659 cttactatggaatctacaagtttgctccacacatgcccaaagcacctaagtcgagattcaaccat 8807595  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 33; Significance: 0.000000002; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 296 - 356
Target Start/End: Complemental strand, 5057535 - 5057475
Alignment:
296 ttttaccacccaccactccatcacgtacaacattgttggtcttatagttgtacggtaaaac 356  Q
    ||||||| | || |||||||||  |||||||||||||||||||| ||||||||| ||||||    
5057535 ttttaccgcgcaacactccatcctgtacaacattgttggtcttacagttgtacgataaaac 5057475  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 119 - 184
Target Start/End: Original strand, 32408434 - 32408499
Alignment:
119 gtctccttcacacatgcccaaaccccctaaatctagattcaaccatctttcctataaaagatgcta 184  Q
    ||||||||||||||||||||||||  |||| |  ||||||||| || ||| ||||||||| |||||    
32408434 gtctccttcacacatgcccaaaccttctaagtagagattcaacaatattttctataaaaggtgcta 32408499  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 33; Significance: 0.000000002; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 70
Target Start/End: Original strand, 7633541 - 7633592
Alignment:
18 tttcttgatagtttctcctatagtgtatcttggtcttcctttgcctctagcaa 70  Q
    ||||||||||||||||||| ||| || ||||||| ||||||||||||||||||    
7633541 tttcttgatagtttctcctgtag-gtttcttggttttcctttgcctctagcaa 7633592  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 84 - 148
Target Start/End: Complemental strand, 43260508 - 43260444
Alignment:
84 catctgatctactctccttactttggaatatacaagtctccttcacacatgcccaaaccccctaa 148  Q
    |||||||||||||||||||||| | |||| |||||||||  |   |||||||||||||| |||||    
43260508 catctgatctactctccttactatagaatctacaagtcttttcttcacatgcccaaaccacctaa 43260444  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 32; Significance: 0.000000009; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 89 - 168
Target Start/End: Complemental strand, 54485637 - 54485558
Alignment:
89 gatctactctccttactttggaatatacaagtctccttcacacatgcccaaaccccctaaatctagattcaaccatcttt 168  Q
    |||||||||||||| || ||||||  | | ||||||| ||||||||| |||||| | |||||  ||||||||||||||||    
54485637 gatctactctccttcctatggaatcgataggtctcctccacacatgctcaaaccacttaaattgagattcaaccatcttt 54485558  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 67
Target Start/End: Original strand, 31261054 - 31261103
Alignment:
18 tttcttgatagtttctcctatagtgtatcttggtcttcctttgcctctag 67  Q
    ||||||||||||||||| |||||| | ||| ||||||||| |||||||||    
31261054 tttcttgatagtttctcttatagtttttctaggtcttcctctgcctctag 31261103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 29; Significance: 0.0000005; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 132 - 192
Target Start/End: Complemental strand, 5335976 - 5335916
Alignment:
132 atgcccaaaccccctaaatctagattcaaccatctttcctataaaagatgctatcccaact 192  Q
    ||||||||||| ||||| ||||| ||| |||||||||||||  | |||||||| |||||||    
5335976 atgcccaaaccacctaagtctagtttcgaccatctttcctactatagatgctaccccaact 5335916  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 84 - 192
Target Start/End: Complemental strand, 46990007 - 46989899
Alignment:
84 catctgatctactctccttactttggaatatacaagtctccttcacacatgcccaaaccccctaaatctagattcaaccatctttcctataaaagatgct 183  Q
    ||||||||||||| || |||||  | ||| || | ||||||| |||||||||||||||| |||||    | |||||||||||||| ||| || || ||||    
46990007 catctgatctactatctttactgcgaaatctataggtctcctccacacatgcccaaaccacctaagatgaaattcaaccatcttttctacaataggtgct 46989908  T
184 atcccaact 192  Q
    | |||||||    
46989907 accccaact 46989899  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 137218 times since January 2019
Visitors: 1446