View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1613_low_8 (Length: 396)

Name: NF1613_low_8
Description: NF1613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1613_low_8
NF1613_low_8
[»] chr8 (2 HSPs)
chr8 (1-266)||(10597666-10597931)
chr8 (232-386)||(10597510-10597664)
[»] chr3 (2 HSPs)
chr3 (182-386)||(53388221-53388425)
chr3 (1-134)||(53388427-53388560)


Alignment Details
Target: chr8 (Bit Score: 174; Significance: 2e-93; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 174; E-Value: 2e-93
Query Start/End: Original strand, 1 - 266
Target Start/End: Complemental strand, 10597931 - 10597666
Alignment:
1 cccttcacttgcagaattgtcactgatatcatcattgttagctcccacaggtgattctttcaaagcagtcgtatcaagtttatcaaccacaataggaatg 100  Q
    ||||||||||||||||||||||||||||| ||||| |||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||    
10597931 cccttcacttgcagaattgtcactgatattatcatcgttagctcccacaggtgagtctttcaaagcagtggtatcaagtttatcaaccacaataggaatg 10597832  T
101 tcactgacctctgattttgatttgcattctgaatccgttttgtcagaaaaattacttgtggaatccaatgcatcagcagcaattacaggactataatctt 200  Q
    ||  |||||||||| ||||||||||||||  ||||||||||||||  || || ||||||||||||| ||||||||||||| |||||||||||   ||| |    
10597831 tcgatgacctctgactttgatttgcattccaaatccgttttgtcaacaagatcacttgtggaatccgatgcatcagcagccattacaggactgctatcct 10597732  T
201 cgttgattaatccatttggtagcattgtagtctttgctctctcacttgatgcagaatcaacatgcg 266  Q
    | |||||||||||||||||||||||||| ||||||| |||||||||| ||||||||||||||||||    
10597731 cattgattaatccatttggtagcattgtggtctttgttctctcacttaatgcagaatcaacatgcg 10597666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 232 - 386
Target Start/End: Complemental strand, 10597664 - 10597510
Alignment:
232 ctttgctctctcacttgatgcagaatcaacatgcgaccgagattcacttccaccatcatcatccttcatacagaaatattccttgggacttccattacca 331  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| | ||||||||||||||||| || |    
10597664 ctttgttctctcacttgatgcagaatcaacatgcgaccgagattcacttctaccatcatcatccttcatacagaactgttccttgggacttccatcacta 10597565  T
332 gtaccttcagatgaatctttttctgatgccactttctcttcttgctgctcttgat 386  Q
    |||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
10597564 gtaccttcagatgaatctttttctgatgccactttctcttcttgttgctcttgat 10597510  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 137; Significance: 2e-71; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 182 - 386
Target Start/End: Complemental strand, 53388425 - 53388221
Alignment:
182 attacaggactataatcttcgttgattaatccatttggtagcattgtagtctttgctctctcacttgatgcagaatcaacatgcgaccgagattcacttc 281  Q
    |||||||||||| |||| || ||||||||||||| |||||||||||||| ||||| |||||||||||| | |||||||||||||||||||||||||||||    
53388425 attacaggactacaatcctcattgattaatccatctggtagcattgtaggctttgttctctcacttgacgtagaatcaacatgcgaccgagattcacttc 53388326  T
282 caccatcatcatccttcatacagaaatattccttgggacttccattaccagtaccttcagatgaatctttttctgatgccactttctcttcttgctgctc 381  Q
    |||| ||||||||||||||||| || | ||||||||||||||| | || | ||||||||||||||||||||||||||||||||||||||||||| |||||    
53388325 caccgtcatcatccttcatacataattgttccttgggacttccctcactaataccttcagatgaatctttttctgatgccactttctcttcttgttgctc 53388226  T
382 ttgat 386  Q
    |||||    
53388225 ttgat 53388221  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 98; E-Value: 4e-48
Query Start/End: Original strand, 1 - 134
Target Start/End: Complemental strand, 53388560 - 53388427
Alignment:
1 cccttcacttgcagaattgtcactgatatcatcattgttagctcccacaggtgattctttcaaagcagtcgtatcaagtttatcaaccacaataggaatg 100  Q
    ||||||||||| |||||  ||||| |||||||||||||| |||||||| ||| |||||||||||||||||||||||| ||||||||||||||||||||||    
53388560 cccttcacttgaagaatcatcactaatatcatcattgtttgctcccacgggtaattctttcaaagcagtcgtatcaaatttatcaaccacaataggaatg 53388461  T
101 tcactgacctctgattttgatttgcattctgaat 134  Q
    || |||||||||||||||||||||||||||||||    
53388460 tcgctgacctctgattttgatttgcattctgaat 53388427  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 137328 times since January 2019
Visitors: 1446