View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1613_low_9 (Length: 382)

Name: NF1613_low_9
Description: NF1613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1613_low_9
NF1613_low_9
[»] chr7 (2 HSPs)
chr7 (17-375)||(32812517-32812875)
chr7 (17-369)||(32830047-32830399)


Alignment Details
Target: chr7 (Bit Score: 347; Significance: 0; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 347; E-Value: 0
Query Start/End: Original strand, 17 - 375
Target Start/End: Original strand, 32812517 - 32812875
Alignment:
17 acgttcaagattgaatcctccattgccgagagagtacgctgggaatgcagttttaacggcgtacgcttcggcaaagtgtgaggaattgaaggaaggtgaa 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
32812517 acgttcaagattgaatcctccattgccgagagagtacgctgggaatgcagttttaacggcgtaagcttcggcaaagtgtgaggaattgaaggaaggtgaa 32812616  T
117 ttctcaaggttggtggagatggtgtgggagggtacaaaaagaatgggtgatgagtatgcaaggtctattattgattggggagaattgtataatggttttc 216  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32812617 ttctcaaggttggtggagatggtgtgggagggtacaaaaagaatgggtgatgagtatgcaaggtctattattgattggggagaattgtataatggttttc 32812716  T
217 cgaatggagagcttttggtgtcttcatggtggaggttagggtttgaagaggtggagtatccatgggggaagcctaagtattgttgtccagtagtttatca 316  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
32812717 cgaatggagagcttttggtgtcttcatggtggaggttagggtttgaagaggtggagtatccatgggggaagcctaagtattgttgtccagtggtttatca 32812816  T
317 taagaaggatattatactattgttcccttcttttcacggaggtgaaggtggtgatgatg 375  Q
    ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
32812817 taagaaggatattatactattgttcccttcttttcacggagttgaaggtggtgatgatg 32812875  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 17 - 369
Target Start/End: Original strand, 32830047 - 32830399
Alignment:
17 acgttcaagattgaatcctccattgccgagagagtacgctgggaatgcagttttaacggcgtacgcttcggcaaagtgtgaggaattgaaggaaggtgaa 116  Q
    |||||||||||||||||||||||||||||||| |||| ||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||    
32830047 acgttcaagattgaatcctccattgccgagagcgtacactgggaatgcagtattaacagcgtacgcttcggcaaagtgtgaggaattgaaggaaggtgaa 32830146  T
117 ttctcaaggttggtggagatggtgtgggagggtacaaaaagaatgggtgatgagtatgcaaggtctattattgattggggagaattgtataatggttttc 216  Q
    || |||||||||||||||||||||   |||||| ||| ||||||| ||||||| |||||||| |||||||||||||||||||| ||||||||||||||||    
32830147 ttttcaaggttggtggagatggtggaagagggttcaagaagaatgagtgatgaatatgcaagatctattattgattggggagagttgtataatggttttc 32830246  T
217 cgaatggagagcttttggtgtcttcatggtggaggttagggtttgaagaggtggagtatccatgggggaagcctaagtattgttgtccagtagtttatca 316  Q
    | ||||| ||  ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||    
32830247 caaatggggatgttttggtgtcttcatggtggaggctagggtttgaagaggtggagtatccatgggggaagcctaagtattgttgtcctgtggtttatca 32830346  T
317 taagaaggatattatactattgttcccttcttttcacggaggtgaaggtggtg 369  Q
    || |||||||||||||||||| || ||||||||| | ||||||||||||||||    
32830347 taggaaggatattatactattatttccttcttttaatggaggtgaaggtggtg 32830399  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 137471 times since January 2019
Visitors: 1448