View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1856_high_11 (Length: 319)

Name: NF1856_high_11
Description: NF1856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1856_high_11
NF1856_high_11
[»] chr5 (1 HSPs)
chr5 (6-295)||(7562019-7562308)
[»] chr8 (1 HSPs)
chr8 (245-281)||(33148838-33148874)


Alignment Details
Target: chr5 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 6 - 295
Target Start/End: Complemental strand, 7562308 - 7562019
Alignment:
6 gtcgaagaatatggccaatgattgagaaatttagtaatttcttagatgttggtaattaagtgtttgttttgatgttgtaaaggaaattgaaagcaagaga 105  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7562308 gtcgaagaagatggccaatgattgagaaatttagtaatttcttagatgttggtaattaagtgtttgttttgatgttgtaaaggaaattgaaagcaagaga 7562209  T
106 aatgnnnnnnnnnnnnnnnnnnngattgatgatgaatggagaaaagatacctgagatgacggataacaggggttctcaacaaaaagaaaaggaaaacatg 205  Q
    ||||                   |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7562208 aatgtttttttaatttattttttgattgatgatgaatggagaaaagatacctgagatgacggataacaggggttctcaacaaaaagaaaaggaaaacatg 7562109  T
206 gttagactaaaaagtacgtaataccaaaggaaccaattattgtctttcctcaatgatctcctacaaaggaggacctctatctttctcaat 295  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||| |||||||||||||    
7562108 gttagactaaaaagtacgtaataccaaaggaaccaattgttgtctttcctcaatgatctcctacaaaagaggacctttatctttctcaat 7562019  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 245 - 281
Target Start/End: Original strand, 33148838 - 33148874
Alignment:
245 ttgtctttcctcaatgatctcctacaaaggaggacct 281  Q
    |||||||||||||||| ||||||||||||||||||||    
33148838 ttgtctttcctcaatggtctcctacaaaggaggacct 33148874  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 18552 times since January 2019
Visitors: 1569