View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1856_high_14 (Length: 271)

Name: NF1856_high_14
Description: NF1856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF1856_high_14
[»] chr6 (1 HSPs)
chr6 (10-253)||(419512-419755)

Alignment Details
Target: chr6 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr6

Target: chr6; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 10 - 253
Target Start/End: Complemental strand, 419755 - 419512
10 gcagagaaaaatatagagtattgattttgacagatggggtgatgccaggattacttcagttaaccgtcgatggaacgtggagagccaaatcgacggctag 109  Q
419755 gcagagaaaaatatagagtattgattttgacagatggggtgatgccaggattacttcagttaaccgtcgatggaacgtggagagccaaatcgacggctag 419656  T
110 ggaattgttgttgcttctgagagactgctctagttatagctcgagaagtacacaaattaatcacaagcttatagaacagataatggaagaaattgataca 209  Q
419655 ggaattgttgttgcttctgagagactgctctagttatagctcgagaagtacacaaattaatcacaagcttatagaacagataatggaagaaattgataca 419556  T
210 gaaggagagaaattgacagatactactttgagattggtagagga 253  Q
419555 gaaggagagaaattgacagatactactttgagattggtagagga 419512  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 125369 times since January 2019
Visitors: 1457