View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1856_high_16 (Length: 227)

Name: NF1856_high_16
Description: NF1856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF1856_high_16
[»] chr3 (1 HSPs)
chr3 (1-227)||(31784854-31785080)

Alignment Details
Target: chr3 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr3

Target: chr3; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 31784854 - 31785080
1 atgatgaaaactttgaacatgtctcaactgagaaccaaaacctttggttgcaagatttgaataatcaggttgatgaaacagttgtttttaaaccatatga 100  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
31784854 atgatggaaactttgaacatgtctcaactgagaaccaaaacctttggttgcaagatttgtataatcaggttgatgaaacagttgtttttaaaccatatga 31784953  T
101 ttttgattcccttgatgatagagtgttgaaattggtaagaaataacttcaacaaaattcttggatccgagtgtgccttacaaatccaaacagaagtcatg 200  Q
31784954 ttttgattcccttgatgatagagtgttgaaattggtaagaaataacttcaacaaaattcttggatccgagtgtgccttacaaatccaaacagaagtcatg 31785053  T
201 gatcaattgcttgcagctgcatacgtc 227  Q
31785054 gatcaattgcttgcagctgcatacgtc 31785080  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 125193 times since January 2019
Visitors: 1454