View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1856_high_17 (Length: 227)

Name: NF1856_high_17
Description: NF1856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF1856_high_17
[»] chr3 (1 HSPs)
chr3 (1-212)||(31785147-31785354)

Alignment Details
Target: chr3 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr3

Target: chr3; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 1 - 212
Target Start/End: Original strand, 31785147 - 31785354
1 cggagaagatacaatctcaccgccagttctattgtgaaacttgttacatgtccagagcaagcttcaagtgtgcaccttccacaaaggatagttttagatt 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
31785147 cggagaagatacaatctcaccgccagttctattgtgaaacttgttacatgtccagagcaagcttcaagtgtgcaccttccaccaaggatagttttagatt 31785246  T
101 gaatacccttcgatgattgttgtcttttctttttgaatgtgtaatttagctgtagcatatatatagtgaaactatcttagtctttaatccctattatttt 200  Q
    |||||||||||| ||||||||||||||||||||||||||| |||||||||||||||    ||||||||||||||||||||||||||||||||||||||||    
31785247 gaatacccttcggtgattgttgtcttttctttttgaatgtataatttagctgtagc----atatagtgaaactatcttagtctttaatccctattatttt 31785342  T
201 gttaggtttctt 212  Q
    ||| ||||||||    
31785343 gttgggtttctt 31785354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 17953 times since January 2019
Visitors: 1567