View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1856_high_17 (Length: 227)

Name: NF1856_high_17
Description: NF1856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1856_high_17
NF1856_high_17
[»] chr3 (1 HSPs)
chr3 (1-212)||(31785147-31785354)


Alignment Details
Target: chr3 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 1 - 212
Target Start/End: Original strand, 31785147 - 31785354
Alignment:
1 cggagaagatacaatctcaccgccagttctattgtgaaacttgttacatgtccagagcaagcttcaagtgtgcaccttccacaaaggatagttttagatt 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
31785147 cggagaagatacaatctcaccgccagttctattgtgaaacttgttacatgtccagagcaagcttcaagtgtgcaccttccaccaaggatagttttagatt 31785246  T
101 gaatacccttcgatgattgttgtcttttctttttgaatgtgtaatttagctgtagcatatatatagtgaaactatcttagtctttaatccctattatttt 200  Q
    |||||||||||| ||||||||||||||||||||||||||| |||||||||||||||    ||||||||||||||||||||||||||||||||||||||||    
31785247 gaatacccttcggtgattgttgtcttttctttttgaatgtataatttagctgtagc----atatagtgaaactatcttagtctttaatccctattatttt 31785342  T
201 gttaggtttctt 212  Q
    ||| ||||||||    
31785343 gttgggtttctt 31785354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 198701 times since January 2019
Visitors: 2773