View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1856_high_19 (Length: 220)

Name: NF1856_high_19
Description: NF1856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF1856_high_19
[»] chr3 (1 HSPs)
chr3 (1-218)||(55103568-55103785)

Alignment Details
Target: chr3 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr3

Target: chr3; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 218
Target Start/End: Original strand, 55103568 - 55103785
1 aatttgaggcagatggaggagctcttttctgggggatagattactacaacaatgaattattgcattctgataaggaacgagttggttctgtgacaacaga 100  Q
    |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
55103568 aatttgaggcagatggagtagctcttttctgggggatagattactacaacaatgaattattgcattctgataaggaccgagttggttctgtgacaacaga 55103667  T
101 gatactattggaaaaagatgagaattccttcacattgcaaaacggatggacatttccaagaagaatatatttcaacggtgaaaactgtgacatgccttta 200  Q
55103668 gatactattggaaaaagatgagaattccttcacattgcaaaacggatggacatttccaagaagaatatatttcaacggtgaaaactgtgacatgccttta 55103767  T
201 cctgacacattccctatg 218  Q
55103768 cctgacacattccctatg 55103785  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 191859 times since January 2019
Visitors: 2831